Talk:Wikipedia to the Moon
Add topicFor a start in selecting topics, I have made a PagePile of the top 100k Wikidata items, by number of sitelinks. The same list, with the number of sitelinks per item, is here for download. We could weed out the non-NS0 pages, then maybe get the top 10K or so for each language. Make a rule that each topic should only be in <=5 languages for variety. --Magnus Manske (talk) 12:55, 21 April 2016 (UTC)
Idea: Use KIWIX and ZIM files
[edit]Hi everyone, I just want to share the following idea: No matter which scenario is being chosen, it might be worth thinking about using ZIM-files to compress the content files and make them accessible with Kiwix. Like this we might be able to store much more content on the disc. I am sure User:Kelson would be glad to help. Best wishes, --Muriel Staub (WMCH) (talk) 12:56, 21 April 2016 (UTC)
if we plan to bring this goal, i think it's very interested to have an Wp alive, updated around time. with internet connection directly between moon to earth
--Mohammed Bachounda (talk) 14:49, 21 April 2016 (UTC)
- While I do like KIWIX very much, the goal here seems to be to put some data on the moon that can be read much later down the line. As such, compressed HTML would be tricky enough; ZIM would likely be unreadable in the near (astronomically speaking) future, compared to HTML. --Magnus Manske (talk) 15:07, 21 April 2016 (UTC)
- ZIM is just compressed HTML; there are worse ways to make stuff unreadable, e.g. unclear charset. I summed up the latest http://download.kiwix.org/zim/wikipedia/ nopic files for all languages and they sum up to 47 GB. 20 GB is not too far, if you consider you can switch to double extreme LZMA compression, remove the index, strip some useless HTML. And all the other Wikimedia projects combined don't take as much space. Nemo 18:02, 21 April 2016 (UTC)
- Here were I live we usually use workarounds anything. No way to convince those guys to accept unpaid 5 grams extra weight and just give them a tiny flash drive (which will take the 47 giga) to squeeze somewhere into that rover? Or just to bribe one of the wiki-sympathetic guys on then project to drop it into a corner of the rover without telling anyone? Sure we will get enough crowd funding for that! --Kipala (talk) 22:19, 21 April 2016 (UTC)
- Any flashmemory will be fried in space. Bytesock (talk) 04:03, 22 April 2016 (UTC)
- The other advantage of Kiwix (beyond a 7-10x compression rate: we can chose to host articles with or without images to save additional space) is that it accommodates having several languages / projects. Stephane (talk) 09:59, 22 April 2016 (UTC)
- Any flashmemory will be fried in space. Bytesock (talk) 04:03, 22 April 2016 (UTC)
- Here were I live we usually use workarounds anything. No way to convince those guys to accept unpaid 5 grams extra weight and just give them a tiny flash drive (which will take the 47 giga) to squeeze somewhere into that rover? Or just to bribe one of the wiki-sympathetic guys on then project to drop it into a corner of the rover without telling anyone? Sure we will get enough crowd funding for that! --Kipala (talk) 22:19, 21 April 2016 (UTC)
- ZIM is just compressed HTML; there are worse ways to make stuff unreadable, e.g. unclear charset. I summed up the latest http://download.kiwix.org/zim/wikipedia/ nopic files for all languages and they sum up to 47 GB. 20 GB is not too far, if you consider you can switch to double extreme LZMA compression, remove the index, strip some useless HTML. And all the other Wikimedia projects combined don't take as much space. Nemo 18:02, 21 April 2016 (UTC)
Bad idea
[edit]I don't think we should send a copy of WP to the moon. A more advanced civilization, finding such an artifact, might decide to wipe Earth out as an act of compassion. EEng (talk) 14:35, 21 April 2016 (UTC)
- Or perhaps they would find the disc and get really into the open source movement. 192.249.47.205 14:58, 21 April 2016 (UTC)
No don't Kelvin store (talk) 19:32, 21 April 2016 (UTC)
Has this been thoroughly thought out?are we sure this is wise?I mean I'm not sayin' that aliens exist but I'm not sayin' they don't either because absence of evidence isn't evidence of absence but if they DO can we afford to assume their friendly?chances are if they DO and can make it here they'll be infinitely smarter than we are we'll have NO cognitive advantage over them whatsoever which will automatically demote us to the second smartest species on the block ( and if you need help with the implications of that go ask the dolphins and apes how that's gone for THEM thusfar)which brings me back to my point;-should we REALLY be handing such creatures which would amount to an existential threat an advantage of this kind??? Won't they have enough already??? Dannyj750 (talk) 19:38, 21 April 2016 (UTC)
- I don't care how smart they are; I just want to tell them about Homestuck. Humor aside, assuming the data on the disc would survive a considerable amount of time, the main purpose of such a disc is to preserve information for the future of humanity. Wikipedia would be a gold mine of archaeological value if we could retrieve it three hundred years from now. Alternatively, it would be nice if an alien species would be able to learn something about us once we're long gone. If an alien species would reach our moon while humanity is still around, they wouldn't need the rover. They could just connect to our networks directly or watch us from afar. A disc like this just a short astronomical distance away from us could never pose a danger to humanity, even in the most ridiculously imagined situations. Maplestrip (talk) 19:56, 21 April 2016 (UTC)
I hope the disc will be equipped with an engine to play it and represent the data in a readable form. Otherwise who will decrypt it after all the civilization on Earth will be ruined?
- I have another idea: send a copy of WP to the moon and delete all copies here on earth. Then we can all get back to living. EEng (talk) 01:34, 22 April 2016 (UTC)
- Dear Everyone, there is a discussion this issue at https://meta.wikimedia.org/wiki/Grants_talk:IEG/Wikipedia_likes_Galactic_Exploration_for_Posterity_2015#A few thoughts of a past project. Geraldshields11 (talk) 21:10, 20 May 2016 (UTC)
Everything?
[edit]Few days ago I read this article. I am sure manufacturers of that optical disk -- even it's in prototype stage -- would be interested to donate one disk for the project. --Millosh (talk) 14:46, 21 April 2016 (UTC)
- I read the same article (for obvious reasons), but I am not sure whether such disc would survive in space. Cheers, —DerHexer (Talk) 14:48, 21 April 2016 (UTC)
- Why wouldn't it survive? Oh btw, 360 PB surely would be enough for WP. Bytesock (talk) 18:25, 21 April 2016 (UTC)
I heard of way we might be able to actually store EVERYTHING! This link here shows how we can store data on DNA, and if this technology develops fast enough, than we might be able to use it to take all of Wikipedia to the moon! Wyatt Hughes (talk) 16:45, 22 April 2016 (UTC)
The sum of all human knowledge?
[edit]Stating Wikipedia's "...content will equal a genuine snapshot of the sum of all human knowledge." is stretching it to the point of inviting mockery from scientists, medical doctors, mathematicians, manufacturers, governments, libraries and others who have amounts great intricate, specialized knowledge not contained in Wikipedia because it is too vast and too far beyond public understanding. The sum of all human knowledge changes daily. Remember when Pluto was a planet?69.204.132.226 19:46, 23 April 2016 (UTC)
- "Snapshot" might indicate that the "sum of knowledge" isn't in-depth, but varied. Wikipedia has articles on internet memes to African mythology, so that might be more varied than you'll be able to find in any library. "Changes daily" seems to define Wikipedia pretty well too. Either way, you think that the team's reason for picking Wikipedia is silly or stupid, but does that really matter? Perhaps we could turn the statement around to some of Wikipedia's more favorite taglines, like it being a symbol for the power of volunteer projects when related to the preservation of knowledge. ~Mable (chat) 20:44, 23 April 2016 (UTC)
- Dear ~Mable I suggest getting a copy of Wikipedia at https://meta.wikimedia.org/wiki/Offline_Projects/Library/OpenZIM_Content_Library from Kelson,Samson Maosa, and Samson Maosa. They have a profanity-free verion and have put a lot of hours into it. Geraldshields11 (talk) 21:17, 20 May 2016 (UTC)
Oversized sitenotice
[edit]Please, could it be smaller? 164 pixels high is idiotic. Sjoerd de Bruin (talk) 14:46, 21 April 2016 (UTC)
- I reduced the size. Cheers, Martin Rulsch (WMDE) (talk) 14:53, 21 April 2016 (UTC)
Scenario: Take me to the Moon!
[edit]Could we just send to the Moon the list of all editors including anonymous? --Igel B TyMaHe (talk) 14:51, 21 April 2016 (UTC)
- Yeah, one of these days, one of these days... Pow! To the moon! -- Llywrch (talk) 15:50, 21 April 2016 (UTC)
JPEG
[edit]Why the title image in the JPEG format? This is the worst possible format for this image. @Elisabeth Mandl (WMDE): May you upload it as SVG or at least as PNG? — putnik 15:04, 21 April 2016 (UTC)
- Ok, thanks for the remark. Done. --Elisabeth Mandl (WMDE) (talk) 15:37, 21 April 2016 (UTC)
Sprache - witzig!
[edit]Eine Forschergruppe aus Berlin, irgendwie ist offensichtlich die deutsche Wikimedia engagiert, aber sicherheitshalber wurde der text nicht ins deutsche übersetzt. Gibt nichtmal einen button zu einer deutsch begonnenen version. Witzig! ...Sicherlich Post 15:07, 21 April 2016 (UTC)
- @Sicherlich:: Schritt für Schritt. Uns war es am wichtigsten, dass erstmal der englische Text da ist, der natürlich übersetzt werden kann. Wenn du eine deutsche Zusammenfassung lesen möchtest, bist du eigeladen den Blogbeitrag (auf Deutsch) dazu zu lesen. Viele Grüße, --Cornelius Kibelka (WMDE) (talk) 15:13, 21 April 2016 (UTC)
- der deutsche verein braucht stunden um den von ihm selbst verfassten text in die eigene sprache zu bringen (bzw. nicht zu bringen; aber bestimmt irgendwann :D ). Ja, das finde ich absurd und witzig. ...Sicherlich Post 15:21, 21 April 2016 (UTC) nein, dies ist keine "beschwerde". vielleicht zum nachdenken anregen, aber ich glaube das ist schlicht so ein deutsches ding
- Schritt für Schritt ... Tage später sind FAQ und About immer noch nicht (bzw. nur teilweise) übersetzt. und selbst Die Wikipedia auf den Mond ist nicht vollständig übersetzt. kopfschüttel. Da es wohl unfähigkeit bzgl. der sprache nicht sein kann, ist es wohl unwille. - da kann man sich dann wohl nicht beschweren wenn WMF auch nur englisch seine infos verbreitet. ... Irgendwer behauptete mit diesen projekt sollen neue autoren geworben werden. wenn WMD sogar schon zu faul ist die eigenen projekte in der eigenen sprache darzustellen, dann ist das werben wohl nur die übliche standardfloskel für projekte die man sonst nicht sinnvoll begründen kann. ...Sicherlich Post 00:15, 24 April 2016 (UTC)
- Hat mit Faulheit nichts zu tun. Aus Erfahrung weiß ich, dass viele Aktive tatsächlich gerne übersetzen. Die Übersetzungen sind ja hier auch gleich wie Pilze aus dem Boden geschossen. War bei der DE-Version dann wohl nicht so, mit der Lust, ok. Habe die About-Seite eben übersetzt, FAQ hatte sich jemand vorher drangemacht (Danke!). Bei den Szenarios bin ich unsicher, wegen der Diskussion (eher unübersetzbar), gucke aber später/morgen nochmal drauf und mache was. Zumindest Einleitung wäre sicher passend, ggf. mit einem Hinweis, dass die Disk. laufend ist und deshalb so belassen wird. Michael Jahn WMDE (talk) 11:22, 25 April 2016 (UTC)
- Hmm, na meiner erfahrung nach werden solche dinge eher schleppend und dann nur teilweise übersetzt. vielleicht liegts daran, dass es von WM-D/F kommt und die freundschaft zw. WP und WM wohl eher eine zweckgemeinschaft ist. - Szenarios und gerade Diskussionen sind Sicherlich schwierig bzw. extrem aufwändig. Wobei hier im zweifel die allergrößte hürde für die partizipation von nicht-englisch-sprechenden liegt. aber eine gangbare lösung hat vermutlich keiner :/ ...Sicherlich Post 07:11, 26 April 2016 (UTC)
- Hat mit Faulheit nichts zu tun. Aus Erfahrung weiß ich, dass viele Aktive tatsächlich gerne übersetzen. Die Übersetzungen sind ja hier auch gleich wie Pilze aus dem Boden geschossen. War bei der DE-Version dann wohl nicht so, mit der Lust, ok. Habe die About-Seite eben übersetzt, FAQ hatte sich jemand vorher drangemacht (Danke!). Bei den Szenarios bin ich unsicher, wegen der Diskussion (eher unübersetzbar), gucke aber später/morgen nochmal drauf und mache was. Zumindest Einleitung wäre sicher passend, ggf. mit einem Hinweis, dass die Disk. laufend ist und deshalb so belassen wird. Michael Jahn WMDE (talk) 11:22, 25 April 2016 (UTC)
- Schritt für Schritt ... Tage später sind FAQ und About immer noch nicht (bzw. nur teilweise) übersetzt. und selbst Die Wikipedia auf den Mond ist nicht vollständig übersetzt. kopfschüttel. Da es wohl unfähigkeit bzgl. der sprache nicht sein kann, ist es wohl unwille. - da kann man sich dann wohl nicht beschweren wenn WMF auch nur englisch seine infos verbreitet. ... Irgendwer behauptete mit diesen projekt sollen neue autoren geworben werden. wenn WMD sogar schon zu faul ist die eigenen projekte in der eigenen sprache darzustellen, dann ist das werben wohl nur die übliche standardfloskel für projekte die man sonst nicht sinnvoll begründen kann. ...Sicherlich Post 00:15, 24 April 2016 (UTC)
- der deutsche verein braucht stunden um den von ihm selbst verfassten text in die eigene sprache zu bringen (bzw. nicht zu bringen; aber bestimmt irgendwann :D ). Ja, das finde ich absurd und witzig. ...Sicherlich Post 15:21, 21 April 2016 (UTC) nein, dies ist keine "beschwerde". vielleicht zum nachdenken anregen, aber ich glaube das ist schlicht so ein deutsches ding
The English language article Moon, the German article Mond, and the corresponding articles in several other languages are featured. Let's take them all to the moon. This could be part of some of the other scenarios. Jonathunder (talk) 15:07, 21 April 2016 (UTC)
- @Jonathunder:: Yeay, you are free to add this idea as another scneario. :) --Cornelius Kibelka (WMDE) (talk) 15:11, 21 April 2016 (UTC)
- Dear @Jonathunder: I also suggest sending this metaproject article to the Moon. Geraldshields11 (talk) 21:21, 20 May 2016 (UTC)
Every article?
[edit]Are we going to send every article (including stubs)? --Лука Батумец (talk) 15:36, 21 April 2016 (UTC)
- Well as the main page says, there is only about 20GB capacity and one of the key things that's being done here is to decide exactly which content to send. Nil Einne (talk) 16:41, 21 April 2016 (UTC)
- 20 GB are probably enough, see #Idea: Use KIWIX and ZIM files. Nemo 18:04, 21 April 2016 (UTC)
As useful as a hole in the head
[edit]Who on the moon needs a copy of the Wikipedia? Invest you time & energy better in quality assurance of the existing articles. Here you can start: w:Category:Articles to be expanded, c:Category:Media needing categories.--Kopiersperre (talk) 15:41, 21 April 2016 (UTC)
- This is great PR. PR gets editors. If only ten good editors come from milking this story, spending a few hours (or even days) of collective time on this is a net win. --Magnus Manske (talk) 15:44, 21 April 2016 (UTC)
- Unless they are loonies. Rich Farmbrough 15:51 21 April 2016 (GMT).
- No need - there, at the moon, is nobody to read Wikipedia! Let's concentrate to work on earth and for the people living here! Stop this madness as fast as possible.--Lutheraner (talk) 15:53, 21 April 2016 (UTC)
- Not now, but there might be in the future. Bytesock (talk) 12:16, 7 May 2016 (UTC)
As already said throughout the talk page, this is a bad idea. It's a publicity stunt, one that makes no sense, that further contributes to a less pristine Moon and environment and wastes the effort that could be put to something actually useful and non damaging. Wikipedia spoils the Moon and spreads its knowledge pearl to our swine friend vacuum, what's next? White Phenom (talk) 16:34, 21 April 2016 (UTC)
- Oh, i watched their talk at 32C3 and i can't wait to see their microwave idea in practice... cheers, --Ghilt (talk) 17:11, 21 April 2016 (UTC)
- It can be our Rosetta stone and memory of a lost civilization if anyone finds our place in less than 2.3 billion years before the inner planet system is fried by the Sun. The location is likely to be out of reach for MAD scenarios for some time. Bytesock (talk) 18:03, 21 April 2016 (UTC)
- *cough* The Moon? In my day, when it came to data preservation, we reached for the stars Flowerpotman (talk) 19:11, 21 April 2016 (UTC)
- If in a distant future somebody came looking in our solar system, they would probably be looking for traces of civilization on earth. The main effect here is imho PR, including possibly gaining new editors, not a rosetta stone. --Ghilt (talk) 10:30, 23 April 2016 (UTC)
- I've made a test with some astronomers showing them this link, they liked the idea. you can get some potential expert users to be more interested and that's a not bad. A drop in the ocean, probably not my drop, but I would not be too sarcastic. So good luck guys.--Alexmar983 (talk) 05:18, 3 May 2016 (UTC)
- Thank you --Ghilt for bringing up the Rosetta Stone. See https://meta.wikimedia.org/wiki/Grants:IEG/Wikipedia_likes_Galactic_Exploration_for_Posterity_2015#Project goals on the talk page. The main idea of a past copy of Wikipedia being an archeological trove is it would show future human generations what we found important. Geraldshields11 (talk) 21:27, 20 May 2016 (UTC)
- In principle yes, but i currently see only a very little chance of mankind destroying all terrestrial copies of wikipedia (online and offline), which would be necessary for a human to go look on an uninhabited distant rock in space without an atmosphere (and not here). If mankind successfully destroyed all copies, would we have the technical ability to go to the moon? I guess burying a few dozen copies on earth would be more helpful for a restart, in that case. --Ghilt (talk) 07:20, 21 May 2016 (UTC)
- If in a distant future somebody came looking in our solar system, they would probably be looking for traces of civilization on earth. The main effect here is imho PR, including possibly gaining new editors, not a rosetta stone. --Ghilt (talk) 10:30, 23 April 2016 (UTC)
- *cough* The Moon? In my day, when it came to data preservation, we reached for the stars Flowerpotman (talk) 19:11, 21 April 2016 (UTC)
Disk space is limited... until it isn't
[edit]So we currently only have the ability to send very small amounts of data to the Moon...?
Why not just wait a few years and surely someone will have worked out a way to increase the data capacity, and we can just send up a full copy of wikipedia without worrying about it.
Computers tend to get faster and capacity tends to increase over time.
I wonder if you could work with these guys... Sounds like the perfect tech to leave on the moon for forever. KellyCoinGuy (talk) 16:20, 21 April 2016 (UTC) http://www.digitaltrends.com/cool-tech/data-storage-technique-packs-360-tb-data-glass-disk-eternity/
- Wait a few years for what? As the page indicates, this is just a side project as part of one teams attempts to win the Lunar X Prize. If the team is successful, their project is going to go ahead with or without the ceramic disc. Maybe some other team will send another lunar rover or some other payload to the moon in the future, and may be they will even offer to send some data, but it's not something significantly relevant to us at the moment. I guess there's a small possibility because we've done this some other team won't offer to send wikipedia in the future, but still doesn't seem that relevant. Nil Einne (talk) 16:37, 21 April 2016 (UTC)
Why not think outside the box? For example, have a speech or address by the Wikipedia/Moon Project translated into English, German, and say, the top 5 languages prevalent on the planet at the time? Video game and other media geniuses also put "Easter Egg" puzzles in their games, and I'm sure any future civilization (human or otherwise) worth their salt can decode it. I would trust the medium (CD-Rom disc, memory stick, or whatever) will at least be hardy enough to withstand the extremes of the lunar environment, otherwise it would be like writing your name on the beach, only for the waves to wash it away. Swilliamrex (talk)
- There are several high capacity possibilities available now. One is to store it on DNA such as this suggests. Then there is HVD. One company was also working on writing data at the molecular level to a piece of plastic. They wrote data to it for something like 21 days but didn't fill it. That would likely survive radiation and other space related elements. Reguyla (talk) 00:28, 22 April 2016 (UTC)
- As I have mentioned elsewhere in this discussion, radiation will do nasty things to plastic, infact most materials. But some fare better than others. And in particular without the risk of shattering or becoming opaque etc. So unless the plastic is tested with high dose radiation, it's unsuitable. There's even a link to a scientific test of various plastic materials in this discussion. Bytesock (talk) 17:19, 25 April 2016 (UTC)
Would leaving a disk on the moon be considered littering?
[edit]Don't we litter enough on our own planet? --Thaabomb (talk) 16:00, 21 April 2016 (UTC)
- we do. but as we have the chance, lets do it elsewhere as well :D ...Sicherlich Post 16:04, 21 April 2016 (UTC)
- You realize the disc is on, like, a rover, right? I don't think having a bit of extra hardware on a rover suddenly makes it "littering". Maplestrip (talk) 17:43, 21 April 2016 (UTC)
- after the rover drove 500 meters it is what? ^^ ...Sicherlich Post 19:03, 21 April 2016 (UTC)
- An archaeological artifact?--Lsanabria (talk) 21:52, 21 April 2016 (UTC)
- hehehe. Point! I'll start using this for all kind of litter in future! :D ...Sicherlich Post 08:05, 22 April 2016 (UTC) how long does it take to make the 500 m so you can call it archaeological artifact after it stopped? :D
- An archaeological artifact?--Lsanabria (talk) 21:52, 21 April 2016 (UTC)
- after the rover drove 500 meters it is what? ^^ ...Sicherlich Post 19:03, 21 April 2016 (UTC)
- You realize the disc is on, like, a rover, right? I don't think having a bit of extra hardware on a rover suddenly makes it "littering". Maplestrip (talk) 17:43, 21 April 2016 (UTC)
Idea: Use tires of rover for data storage
[edit]With not much room being available on the rover, why not just use its existing parts/surfaces/etc. for data storage? For example: The tires can be made out of intelligent fabric[1] using hydrogenated boron nitride nanotubes [2] to protect against GCRs so all of WP, in every language, would be able to fit and last, basically, forever. Just wondering. Thanks. Picomtn (talk) 16:00, 21 April 2016 (UTC)
- That's actually a really good idea. There is no wind or weather to destroy the regolith-printed text, though meteoroids would have a degrading effect long term. The advantages of using printed text over, say a small flash drive are multifold. For one, text printed in such a manner is much easier to find by scanning the moon and to recognize as made by an intelligent lifeform than a tiny flash drive. It does not assume any capabilities besides scanning to read (other than a flash drive would). There is of course the difficulty of using man-made languages, but that's a hard issue to resolve.
- The key question in my mind would be what the minimal usable resolution is. Surely that there is a limit on resolution given by the size of the grains found on lunar regolith. For instance, let's assume the minimal text size that remains legible for a long time is 2mm^2 per letter. Assuming the two rear wheels are 20cm in width in total, and moving at 5cm per second (very optimistic on the intelligent fabric capabilities), we can write 5,000 letters per second. en:User:Tompw/bookshelf suggests English Wikipedia has around 18 billion characters. So it'd take four million seconds, so around 46 days. All of Wikipedia language versions surely less than a year. (Things could of course be sped up by using compression and different encodings, but then readability is sacrificed) --Tobias talk · contrib 12:55, 22 April 2016 (UTC) Ps.: Printing on Lunarcrete might also be an option.
- Interesting, @Picomtn: The tires are 3D printed, and not made of the material you mention. I'll get the info what they're made of (and why :) --Michael Jahn WMDE (talk) 07:03, 25 April 2016 (UTC)
- (cc @David Eppstein:) Ok, with 3D printed tires then, how about with an eutectic system[1] using atomic trios?[2]? Thanks. Picomtn (talk) 21:52, 13 May 2016 (UTC)
- Interesting, @Picomtn: The tires are 3D printed, and not made of the material you mention. I'll get the info what they're made of (and why :) --Michael Jahn WMDE (talk) 07:03, 25 April 2016 (UTC)
Why not to use SSD?
[edit]In discussion it is said that using SD will result in radiation that damages the card. then why not we use SSD which comes up with case and we can even make a protective case to survive the radiation. The life/ durability is also good. and mostly importantly we get more space to store. ----Sulthan90 (talk) 16:05, 21 April 2016 (UTC)
- You can't just buy a bog standard SSD and put in a protective case. It's still unlikely to survive the conditions (temperature including changes and radiation). Also as the main page indicates and FAQ also says, dimensions and weight both matter. I don't know what the size and weight of this ceramic disc is going to me like, but there's a fair chance even a standard SSD could be more, let alone once you add a protective case. Also while new fresh standard SSDs tend to have decent unpowered data retentions times, even those retention times aren't really that decent when we're talking about something sent to space (20 years is hardly anything). You can get flash memory suitable for use in space, possibly the project is even going to use it for their equipment, However the capacity is going to be a lot less than what you expect from normal flash and even then they still often rely on redundancy and I expect long term unpowered data retention (particularly in conditions in space) is still not going to be that impressive. Admitedly I'm not really sure how long it's estimated this ceramic disc will last, but it's hardly surprising if it's a lot longer than you could conceivably get from flash. Nil Einne (talk) 16:31, 21 April 2016 (UTC)
- Along the same lines. Any device that uses any kind of flash memory is doomed in space. The state of trapped electrons during long times spans bombarded with high energy radiation will wipe both the data and the circuitry to read it. Bytesock (talk) 18:07, 21 April 2016 (UTC)
Bad idea
[edit]I really don't think it is a good idea for the communication of the WMF. Waste of time and waste of money. --Nouill (talk) 16:24, 21 April 2016 (UTC)
- @Nouill: I agree. Rubbish computer (HALP!: I dropped the bass?) 18:18, 21 April 2016 (UTC)
I disagree...it could be a sort of time capsule to future generations, or to any alien civilization that might stumble onto it. And for the here and now, it would help to involve present and future shareholders of Wikipedia who are dedicated and involved in pursuing and preserving knowledge. Swilliamrex (talk)
- Also, Part-Time Scientists is paying for this, not the Wikimedia Foundation. Spirit of Eagle (talk) 01:51, 22 April 2016 (UTC)
Nonsense
[edit]Let's keep Wikpedia on Earth, I think Ambrose Bierce defines in The Devils Dictionary an edtor who can separate the wheat from the chaff, and print the chaff.'. This is( a stupid suggestion and I agree it should not be blocking others' editors on every time they load a page. There is already, a British invention, that was sent into orbit in 1974 and is now on the outskirts of the known solar system. There are already plaques on the moon. Wikipedia does when people, thousands or millions of them, boldly edit, revert, and discuss, to the "unspeakable bounty of human knowledge", as Bierce put it but Jimbo Wales never did. When I can go the moon I shall buy a ticket, but before that, it is just nonsense. SimonTrew (talk) 16:56, 21 April 2016 (UTC)
- I disagree. Why should we, as a civilization and a race, confine and constrain ourselves? What would be the point of all our human endeavors if we put arbitrary caps on them?
- What has been sent is mostly "hey we are here", while wikipedia show how it is. Bytesock (talk) 06:10, 23 April 2016 (UTC)
Let's not put a "Let's take Wikipedia to the moon" banner on every page
[edit]I propose let's not "Let's take Wikipedia to the moon" should not be on every fucking page at Wikipedia, the free encyclopaedia that anyone can edit. Not if that banner is in the fucking way they can't. Whose stupid idea was that? SimonTrew (talk) 17:09, 21 April 2016 (UTC)
- I sympathise, SimonTrew, but you can close it. --Rubbish computer (HALP!: I dropped the bass?) 17:18, 21 April 2016 (UTC)
- Just a note: It's just visible to logged-in users who are affected by this initiative. Martin Rulsch (WMDE) (talk) 17:33, 21 April 2016 (UTC)
- I have never logged in from the moon, and never expect to. The only way I am affected by this publicity stunt is being spammed with the banner. ~ Ningauble (talk) 13:24, 22 April 2016 (UTC)
- Wikipedia, free of advertising. Oh waaaaiitt .. :P Bytesock (talk) 18:14, 21 April 2016 (UTC)
Some of us might like to be involved in things like this. Who wouldn't want to be involved in the Moonshot, or some other momentous part of history? It's not like people are forced to log on, let alone contribute and edit articles. Swilliamrex (talk)
- It's okay. But being informed about it every 10 minutes on wikipedia is wasting the attention span. Bytesock (talk) 04:00, 22 April 2016 (UTC)
- Its spam, but lately its common to use banners für all kinds of unimportant informations. you can stop them by adding
#siteNotice { display: none; }to your css ...Sicherlich Post 08:08, 22 April 2016 (UTC)
- Its spam, but lately its common to use banners für all kinds of unimportant informations. you can stop them by adding
- IMO mailing lists and global message delivery to community village pumps are enough. No need to add huge banners... --Stryn (talk) 08:27, 22 April 2016 (UTC)
Portuguese
[edit]I don't get why there is Portuguese and Brazillian Portuguese. We are only ONE Wikipedia, not two. Please, unify!--MisterSanderson (talk) 17:43, 21 April 2016 (UTC)
- Indeed there is only one Wiki, but still, the distinction should and is generally made elsewhere. Just to comment on it, I'm a native Portuguese and have a little trouble understanding Brazilian Portuguese, and above all, it's very annoying to put up with it, as to us it's a plain out awkward way of speaking. Or should I say, "it's very tickles to carry on top with it, as to the people it's a coo-coo mannerism of chatting about." That's pretty much the feel of reading Brazilian. 2001:8A0:4302:5B01:E85C:DCA5:1E73:5700 22:14, 21 April 2016 (UTC)
Impossible to edit a specific section on the content page
[edit]Because there's no option to edit a specific section on the content page. It becomes very tedious to work with. To the point of almost not bothering. Bytesock (talk) 18:17, 21 April 2016 (UTC)
Top Importance -> FA Class
[edit]Why not either take Version 1.0 to the moon or create a subset of Wikipedia that includes Top/High Importance articles as well as FA, FL, A-Class, and GA articles. I added it up, and that'd come to roughly 244,219 articles. With Encyclopedia Brit at 40k article, that makes this subset of Wikipedia still a comprehensive encyclopedia.--TParis (talk) 18:29, 21 April 2016 (UTC)
- Simply basing it on importance, quality, and perhaps other initiatives like Vital Articles and Version 1.0, seems like one of the best ideas to me as well. It is also easy, as it doesn't take much overhead compared to manually choosing every article and checking if they're any good. Maplestrip (talk) 18:49, 21 April 2016 (UTC)
- Sorry, I should have followed up on this before, though I didn't want to pre-empt things. In fact WP1.0 has just (this past week) got a new lease of life; the Kiwix people have updated the code, and we now have a new person working on getting collections assembled again (our last person for that retired in 2011). Rather than just Top/High importance, I'd recommend using the points system that includes "external interest points", otherwise you get articles that are high importance for (say) Wikipedia:WikiProject The KLF but ignore something that's mid-importance for Wikipedia:WikiProject_Music. We have a new API that just opened up at [wp1.kiwix.org]. Walkerma (talk) 05:07, 4 May 2016 (UTC)
Effect of radiation...
[edit]I suppose we do not have possibility to lock Wikipedia storage into safe place on Moon, hidden from cosmic rays and extremly low temperature. So do not care – we can send anything – anyway it will be readable by very short time... Look: [3] [4] Kenraiz (talk) 18:34, 21 April 2016 (UTC)
- I think we can contribute to a valuable experiment on survival of the data in a heavily irradiated environment with wild variations of the temperature (it can get pretty hot there, too). It may be important for future plans of prolonged stays on the surface of the Moon. I'd love to see it recovered one day! And in case anything survives up to that point, let's send good articles. Szczureq (talk) 13:04, 22 April 2016 (UTC)
Technical unclearities [Unrelated Discussion]
[edit]Giving this its own subsection, since it does not address any of the points above --Tobias talk · contrib 13:04, 22 April 2016 (UTC)
- guys! This is PR! if some alien race will make it to our solar system they will search on earth not on the moon. So put a Wikipedia-dump on a SD-card and throw it into your garden. It more likely to be found :D ...Sicherlich Post 08:12, 22 April 2016 (UTC)
- It is indeed PR, though it is not unfeasible that less knowledge could be extracted from Earth even just a hundred years from now than that we can now send to the moon. If the storage could survive a thousand years, it would easily be the most incredible archaeological find of all time. So yeah, it's worth thinking about, and I think taking it seriously might make for some cool PR as well. "Did you know that the Wikipedia articles sent to the moon can still be read a thousand years from now?" Maplestrip (talk) 08:17, 22 April 2016 (UTC)
- what kind of event would destroy the whole earth deep into the grounds that all human buildings (including bunkers), servers aso. get wheeped out with no trace left? atomic war followed by several impacts of giant meteorites? true, its possible :D ...Sicherlich Post 08:23, 22 April 2016 (UTC)
- Just an atomic war is plenty to destroy basically all of our culture. We'd have some nice underground structures, I guess, but that's a lot less interesting (to me, anyway), than finding writings. A 1984-esque culture death - or simply large changes in culture in general - could also result in a lot of this information getting destroyed on Earth. It's impossible to say, but what is nicer than leaving a snapshot of our culture as it is now where it could remain safe for a long period of time? Maplestrip (talk) 08:35, 22 April 2016 (UTC)
- a war can destroy human kind or its culture but to destroy all the wikipedia dumps existing already on earth: well. no. and in the unterground structures are e.g. servers and computers and for sure on several military bunkers you will find copies of WP; just in case. ... if you would be an alien race; where would you search? on the moon where is acutally nothing or on the planet where you find a lot of hints of (former) intelligent life? searching on the moon a tiny metal thing? well, yes. sure ^^ ...Sicherlich Post 08:54, 22 April 2016 (UTC) PS: I'm not a hard core opponent of the idea. Put IMO: don't put to much energy into this. its just PR
- "We personally possess the nuclear power to destroy the world 50 times over," that kind of stuff. I'm not entirely sure what we're arguing about, though: we get the opportunity to send something to the moon. That's pretty cool, and it would be even cooler if people can still access the information a hundred years from now. It's not like we have any reasons not to take this seriously. Good PR is well thought-out PR. Thus far, the whole idea seems to be pretty poorly executed, though. I really want these technical aspects cleared up. ~Mable (chat) 09:01, 22 April 2016 (UTC)
- yeah sure. what is the reason for the overkill? the defense. So the US would send much more bombs to moskva then needed because some dont get there. but in most cities most buildings would just not be harmed (only the radiation would kill them. Thats how the overkill would work). so the DVD you just burned with the wikipedia-dump still exists. as well the one they use on the several arctic posts, in siberia, the kalahari, aso. ... but sure, maybe some DVD and all electronic destroying bomb will be invented (scnr) ...Sicherlich Post 09:20, 22 April 2016 (UTC)
- "We personally possess the nuclear power to destroy the world 50 times over," that kind of stuff. I'm not entirely sure what we're arguing about, though: we get the opportunity to send something to the moon. That's pretty cool, and it would be even cooler if people can still access the information a hundred years from now. It's not like we have any reasons not to take this seriously. Good PR is well thought-out PR. Thus far, the whole idea seems to be pretty poorly executed, though. I really want these technical aspects cleared up. ~Mable (chat) 09:01, 22 April 2016 (UTC)
- a war can destroy human kind or its culture but to destroy all the wikipedia dumps existing already on earth: well. no. and in the unterground structures are e.g. servers and computers and for sure on several military bunkers you will find copies of WP; just in case. ... if you would be an alien race; where would you search? on the moon where is acutally nothing or on the planet where you find a lot of hints of (former) intelligent life? searching on the moon a tiny metal thing? well, yes. sure ^^ ...Sicherlich Post 08:54, 22 April 2016 (UTC) PS: I'm not a hard core opponent of the idea. Put IMO: don't put to much energy into this. its just PR
- Just an atomic war is plenty to destroy basically all of our culture. We'd have some nice underground structures, I guess, but that's a lot less interesting (to me, anyway), than finding writings. A 1984-esque culture death - or simply large changes in culture in general - could also result in a lot of this information getting destroyed on Earth. It's impossible to say, but what is nicer than leaving a snapshot of our culture as it is now where it could remain safe for a long period of time? Maplestrip (talk) 08:35, 22 April 2016 (UTC)
- what kind of event would destroy the whole earth deep into the grounds that all human buildings (including bunkers), servers aso. get wheeped out with no trace left? atomic war followed by several impacts of giant meteorites? true, its possible :D ...Sicherlich Post 08:23, 22 April 2016 (UTC)
- It is indeed PR, though it is not unfeasible that less knowledge could be extracted from Earth even just a hundred years from now than that we can now send to the moon. If the storage could survive a thousand years, it would easily be the most incredible archaeological find of all time. So yeah, it's worth thinking about, and I think taking it seriously might make for some cool PR as well. "Did you know that the Wikipedia articles sent to the moon can still be read a thousand years from now?" Maplestrip (talk) 08:17, 22 April 2016 (UTC)
- guys! This is PR! if some alien race will make it to our solar system they will search on earth not on the moon. So put a Wikipedia-dump on a SD-card and throw it into your garden. It more likely to be found :D ...Sicherlich Post 08:12, 22 April 2016 (UTC)
How many articles can be taken to the moon?
[edit]This is still not clear to me. Let's say for purposes of discussion that the average article we take up there is 50-70KB Purplebackpack89 19:13, 21 April 2016 (UTC)
- It says 20 GB. If we assume one article has 70 kB, that would make about 20GB/70kB=300 000 articles. For 50 kB it would be 400 000. --RookJameson (talk) 21:38, 21 April 2016 (UTC)
- The article Hard disk drive as wikicode is 113 kB and with bzip -9z 36 kB. Thus perhaps slightly less number of articles fit, unless some serious compression is used. The image thumbnails used takes 478 kB, and they are hard to make into any lesser size. Bytesock (talk) 17:34, 25 April 2016 (UTC)
Idea: Send to the moon articles about...
[edit]...garage bands, bus stops in the Czech republic, asteroids orbiting Pluto and a few other "select" articles.
And leave them there.
20:09, 21 April 2016 (UTC)
- Agree. I'd also transport all the hyper-marketing articles about for-profit companies to the Moon. David spector (talk) 00:32, 22 April 2016 (UTC)
- I honestly really love the idea of sending information on the seemingly trivial. It has something romantic about it. I'd support the idea of sending only low-importance articles or something like that. Maplestrip (talk) 07:55, 22 April 2016 (UTC)
Languages?
[edit]If we're going to imagine the disk will be useful to future archaeologists, what way will it be useful? As a rosetta stone with which they can use known languages to decode unknown ones? Or as a store of information, where once decoded it provides a trove of information they have no other source for?
Those two scenarios are at opposite sides of the language question. If this is to be a rosetta stone, then it should have duplicate copies of articles in every language. Even then, it might make a poor rosetta stone because the articles are only occasionally translations of each-other.
If this is to be a knowledge store, it'd be better to use a single language. (German? Simple-English?) That way once they've worked out the language they have easy access to the entire contents without also having to crack even more dead languages. This discussion only applies if the disk can seriously survive until modern languages are dead, otherwise it's a moot point.ApLundell (talk) 20:45, 21 April 2016 (UTC)
- The Rosetta stone had advantage. "We" knew one of the languages on it. For a alien or future descendants, it might not be so at all. It might be compared to learn an illiterate adult Japanese or a newborn English. So instead of multiple languages. Illustrations on how to understand one language at all is perhaps the better choice. Bytesock (talk) 21:18, 21 April 2016 (UTC)
Political solution
[edit]As far as aliens are concerned i think the idea is baseless. If someone makes it to the earth moon (why ??????) in some dozend-hundred-thousand-billion years they will have better archaeological methods to find out out what they want to know than trying to understand the syntax of wikipedia entries. So its basically a project to serve our own egos (male computer owners with social-emotional deficits, high percentage of space travel dreamers, plus a few female employees of WMF). Which is a noble purpose, though, because that is the basic reason for the existence of wikipedia, which is worthwhile, nevertheless. So: if it does not really matter what we send up (as long as SOMETHING goes to the MOON) we can downsize.
I propose the entry about every wikipedia-version-language in that language, and if somebody still likes to edit: the articles about the countries where that language is official in the language itself. That is doable and looks politically correct (though threatening an edit explosion in minor wikipedias, which is useful, still). AND for my area: all East Africans will be proud!!
Maybe plus the W:Shanghai Fugu Agreement (just because I won that looming edit war, but it is not really urgent). Greetings from Swahili Galaxy --Kipala (talk) 22:35, 21 April 2016 (UTC)
Software experiment
[edit]Why don´t they do a scientific experiment with software? They could try to transform a Wikipedia article into a form with lots of redundancy and see how the text is changing over time by radiation. They want to send pictures back to earth, therefore they could send back a copy of this text from time to time and this way we could see how the data has changed. Maybe it is possible to find an error-correcting code that keeps the article readable a long time. --Goldzahn (talk) 23:00, 21 April 2016 (UTC)
There is already a core list of articles
[edit]There is already a list of "vital" articles here that would be good to include so that would be a good place to start. That's only about 1000. This includes articles on people such as Homer, Confucius, Plato, Einstein and Shakespeare. We've also got the articles for Version 1 release that can be included. That's about 70,000 articles I think, but also includes the Vital articles. Reguyla (talk) 23:25, 21 April 2016 (UTC)
Remove banner
[edit]Hello! Please remove that banner ASAP. And please don't waste time and money on silly stuff like this. The Quixotic Potato (talk) 00:28, 22 April 2016 (UTC)
- Agree. It's embarrassing and also a bad precedent. David spector (talk) 00:37, 22 April 2016 (UTC)
- This is one of the worst ideas ever.
acagastya ✉ Dicere Aliquid :) 00:59, 22 April 2016 (UTC)- Um, the FAQ states that this is a "a gift, no strings attached". Part-Time Scientists is the group paying for this, not the Wikimedia Foundation. Honestly, I think this project is really cool, and I'm really not seeing much of a downside to doing this. Spirit of Eagle (talk) 01:45, 22 April 2016 (UTC)
- It's so annoying every time I open WP to have to look at this stupid publicity stunt. Yes, I know I could change my CSS, but, honestly: Where have we got to when I as a longtime editor must take to protecting myself against spam from WMF or WMDE? --Jossi2 (talk) 08:38, 22 April 2016 (UTC)
- It's just one click on the cross and the banner won't be annoying anymore. :-) --Steinsplitter (talk) 14:57, 22 April 2016 (UTC)
- Spam isn't a problem either. You just have to delete.. delete.. delete.. delete.. delete.. delete.. delete.. delete.. delete.. delete.. delete.. delete.. delete.. delete.. delete.. delete.. Bytesock (talk) 19:16, 22 April 2016 (UTC)
- It's just one click on the cross and the banner won't be annoying anymore. :-) --Steinsplitter (talk) 14:57, 22 April 2016 (UTC)
- It's so annoying every time I open WP to have to look at this stupid publicity stunt. Yes, I know I could change my CSS, but, honestly: Where have we got to when I as a longtime editor must take to protecting myself against spam from WMF or WMDE? --Jossi2 (talk) 08:38, 22 April 2016 (UTC)
- Um, the FAQ states that this is a "a gift, no strings attached". Part-Time Scientists is the group paying for this, not the Wikimedia Foundation. Honestly, I think this project is really cool, and I'm really not seeing much of a downside to doing this. Spirit of Eagle (talk) 01:45, 22 April 2016 (UTC)
- This is one of the worst ideas ever.
WHY?
[edit]Well, I feel this is one of the ridiculous ideas I have ever heard of. Why waste so much of time and effort? And for whom? Is it for those bacterias that might be there on the Moon's surface? Or for name sake? I really wonder why? As if we are going to get a reply: Vielen Dank für so viel von *alten* Informationen! Mais nous ne parlons pas des créatures de ces langues.
acagastya ✉ Dicere Aliquid :) 00:57, 22 April 2016 (UTC)
- In the feature when Earth has transformed into a dystopian 1984 style society, perhaps our descendants will stumble on the disc and upset the powers that are of that time. Bytesock (talk) 03:58, 22 April 2016 (UTC)
- I wonder about the same thing - Why are we doing this?!!!!--Reem Al-Kashif (talk) 07:43, 22 April 2016 (UTC)
- If a dystopian 1984-style society would find it, they wouldn't be able to translate most of it to anything other than "THOUGHTCRIME". And then they'd destroy it ^_^ That being said, I would expect people on Wikipedia would understand the gratification of preserving information for future generations, creating an archaeological artifact? I'm personally surprised we haven't done this already ten times over. Then again, I also don't comprehend why we haven't started a plan for directed panspermia yet, so what do I know? Maplestrip (talk) 08:02, 22 April 2016 (UTC)
- I wonder about the same thing - Why are we doing this?!!!!--Reem Al-Kashif (talk) 07:43, 22 April 2016 (UTC)
Wikipedia-o-centric
[edit]Thanks again for missing that the Wikimedia Foundation runs more projects than Wikipedia. Lugusto • ※ 01:51, 22 April 2016 (UTC)
- Now that is a point, @Lugusto.
acagastya ✉ Dicere Aliquid :) 13:45, 22 April 2016 (UTC)
previous related projects
[edit]Please see Grants talk:IEG/Wikipedia likes Galactic Exploration for Posterity 2015. Some discussion of making a space-based Wikipedia time capsule.
This is dumb.
[edit]I'm as enthusiastic about space exploration as anyone. But sending a copy of Wikipedia to the moon, where it will be quickly forgotten and lie undisturbed until the sun becomes a red giant, is dumb. Having a politically correct argument about which languages to include is even dumber. Get a life. Novel compound (talk) 05:29, 22 April 2016 (UTC)
Anyone who can go to the moon can get to earth
[edit]Why would any spacecraft or any alien being capable of coming this close to Earth stop at the moon to pick up anything? The concept is ridiculous. 69.204.132.226 19:57, 23 April 2016 (UTC)
- The idea is primarily intended as a time capsule for future human generations, if you read the page more carefully. ~Mable (chat) 20:44, 23 April 2016 (UTC)
- After carfully reading the FAQ: "...we’ll leave it there so that aliens who come by have something nice to read" well .oO ...Sicherlich Post 00:01, 24 April 2016 (UTC)
Quality
[edit]I agree to those people who say this project is all about public relations. In this case, we should send only "excellent articles" to the moon. That would be a signal to those who use WP what they hopefully can expect, to those who criticize WP what is intended, and to those who work on WP what is a worthy goal. There are excellent articles about many different topics so the range of valuable information is very wide. (And, just in case some space-archaeologists DO find the articles in centuries, they might get the best impression we can make ...) Colus (talk) 06:34, 22 April 2016 (UTC)--
- Good argument ^_^ Maplestrip (talk) 08:06, 22 April 2016 (UTC)
Real non-volatile storage that can handle space radiation
[edit]Why flashmemory in space is a bad idea, ie NASA Opportunity (rover) launched in 2003:
In December 2014, NASA reported that Opportunity was suffering from "amnesia" events in which the rover fails to write data, e.g. telemetry information, to non-volatile memory. The hardware failure is believed to be due to an age-related fault in one of the rover's seven memory banks. As a result, NASA had aimed to force the rover's software to ignore the failed memory bank,[18] however amnesia events continued to occur which eventually resulted in vehicle resets. In light of this, on Sol 4027 (May 23, 2015), the rover was configured to operate in RAM-only mode, completely avoiding the use of non-volatile memory for storage.
tanisys.com: Effect of Radiation on Solid State Drive (SSD)
- Displacement Damage Dose (DDD), permanent damage to the semiconductor memory cells.
- Total Ionizing Dose (TID), makes some switches harder to turn on and the others harder to turn off
- Single Event Effect (SEE), cause a “soft error”
Plain retention on the surface of Earth is dismal at best:
- "Today's flash devices, which do not require flash refresh, have a typical retention age of 1 year at room temperature." cmu.edu 2015
Here's some ideas for more reliable storage:
southampton.ac.uk, ultrafast laser into fused quartz gives 360 TB/disc.
Another approach is laser beam through glass onto a layer of tungsten. Which very resistant to chemical degrading. Some numbers to get an idea on storage, 10 µm x 10 µm grooves on 4.2 x 4.2 cm (1.7x1.7") plate is enough to store a 2 terabyte version of Wikipedia.
Contains Polycarbonate plastics, which brittles from radioactivity >2.5 Mrad (25 kGy):
- Holographic Versatile Disc, 6 TB
- M-DISC Blu-ray single layer, 25 GB
- Blu-ray BDXL, 128 GB
Discs in general:
- Archival Disc, 300 GB
3D storage:
wikimedia.org discussion on the matter of storing wikipedia permanently.
- Laser micro-etching into nickel.
- Focused ion beam etching, nickel-coated silicon, 25 kUS$ per disc
- Microfiche (plastic)
- Film inside jewelry
Bio storage:
- DNA Storage, 10 000 GB (slow read!)
Size of wikipedia: Size of Wikipedia 2015, 100 GB compressed using 7-Zip. Plain article text 11.5 GB. Media used in all language versions in 2014, 23 TB.
Is there any specification on the weight and volume on what can be brought along with the space probe? Bytesock (talk) 07:04, 22 April 2016 (UTC)
(self answer), According to User:Michael Jahn WMDE a bit further up in the discussion page as of now. The specified media is a Blu-ray M-DISC storage media using single layer for a capacity of 25 GB. Bytesock (talk) 19:31, 22 April 2016 (UTC)
- @Bytesock: Do you think a M-DISC would handle being on the moon? Although it may brittle, it is much stronger than a conventional Blu-ray disc. It may also be able to withstand the radiation if it stays in the rover or is otherwise shielded properly. Tonystewart14 (talk) 08:34, 22 April 2016 (UTC)
- @Bytesock and Tonystewart14: In a section below (I wrote it there not noticing the existence of this thread), I heard of a better alternative that could be a pioneering storage system if carried out as an experiment. The "five-dimensional glass storage" discs are able to hold 360 TB and last a long time, yet are also very small in size, light and heat-resistant. This is probably more symbolic than practical, so it would be the perfect opportunity to test the discs in glass in cooperation with the University of Southampton. Thing is even if we bring the glass chip and it fails, there would probably still be space left for a backup conventional storage system. The Average Wikipedian (talk) 15:59, 22 April 2016 (UTC)
- The team knows about the 360 TB storage, and they're looking into it. It's made of Quartz, if I'm not mistaken. Quartz might actually be most suitable for our purpose, but, as with the 100 GB M-Disc I commented on above, it's not tested. Also, consider how the M-Disc works: Data is arranged in a single line, spiraling inwards, composed of 1's and 0's. This five-dimensonal storage is different in so far, as it is much more difficult to understand/convey in which direction the data is to be read. There's a thousand possible angles/points of view to interpret the data. This is a lot more complicated for any potential reader to decipher. --Michael Jahn WMDE (talk) 18:50, 22 April 2016 (UTC)
- @Bytesock and Tonystewart14: In a section below (I wrote it there not noticing the existence of this thread), I heard of a better alternative that could be a pioneering storage system if carried out as an experiment. The "five-dimensional glass storage" discs are able to hold 360 TB and last a long time, yet are also very small in size, light and heat-resistant. This is probably more symbolic than practical, so it would be the perfect opportunity to test the discs in glass in cooperation with the University of Southampton. Thing is even if we bring the glass chip and it fails, there would probably still be space left for a backup conventional storage system. The Average Wikipedian (talk) 15:59, 22 April 2016 (UTC)
- @Michael Jahn WMDE:It may not be strictly necessary to use all 5-dimensions, instead a simple X-Y pattern can be used. The storage capacity will most likely be sufficient anyway. 2 TB should be enough to cover the English Wikipedia without history and with images sizes actually used. As mentioned earlier, 10x10 µm groves on a 4x4 cm platter will accommodate this. Bytesock (talk) 20:07, 22 April 2016 (UTC)
- The limited details mentioned here supports what I was thinking, the team have looked and are looking at various other ideas and settled on their choice which turns out to be an M-DISC (first thing I thought of but was wondering if they were thinking of something fancier). It sounds like it's still a possibility they will change their minds (whether based on our feedback or simply their own research). So there's not wrong with discussing feasible (i.e. ones that have a chance of surviving and being ready in time) alternatives ideas. But we should still plan under the assumption 20 GB is it. Nil Einne (talk) 18:00, 23 April 2016 (UTC)
- I think a sponsor deal with Southampton university optics lab or their commercial spinoff would be a win-win for both parties. The disc company gets awareness of their product and can later test if their product works after a few years. And WMF don't have to pay for it.. As a bonus all of Wikipedia will fit. So the sorting task can be omitted. Bytesock (talk) 18:29, 23 April 2016 (UTC)
- The limited details mentioned here supports what I was thinking, the team have looked and are looking at various other ideas and settled on their choice which turns out to be an M-DISC (first thing I thought of but was wondering if they were thinking of something fancier). It sounds like it's still a possibility they will change their minds (whether based on our feedback or simply their own research). So there's not wrong with discussing feasible (i.e. ones that have a chance of surviving and being ready in time) alternatives ideas. But we should still plan under the assumption 20 GB is it. Nil Einne (talk) 18:00, 23 April 2016 (UTC)
- @Michael Jahn WMDE: I think that having a complete copy of Wikipedia is far more important than simplicity. There must be a simple way to include an explanation of how the disk works ... seems like the sort of thing you could explain with one of those gold plates they sent out on early space probes. And someone finding the disk has time to try to figure it out. The information isn't exactly encrypted; it should just take some working out to find the runs of zeroes on the disk and go on from there. I don't think we should dismiss this idea on such a triviality! Wnt (talk) 20:33, 26 April 2016 (UTC)
- @Wnt: I like your argument very much that a complete copy may make more sense than simplicity. I'm not dismissing it, at all. I'd love to see people discuss how to do it. I'm justing pointing out the circumstances we need to consider (because we cannot change them): All the materials and processes involved in the work of the Part-time Scientists are mission-critical. It's their project, their expertise and their risk management. We can fill the disc, any way we want (so cool!). That's the gift. We cannot decide to switch materials or mediums of a space mission, e. g. add a golden plate. But as I said, the team is looking for alternatives, and when they are confident with a tested medium that works better for them (data, weight, size, durability, space conditions) they'll tell us right away! Until then it's 20 GB :) --Michael Jahn WMDE (talk) 07:14, 27 April 2016 (UTC)
- @Michael Jahn WMDE:It may not be strictly necessary to use all 5-dimensions, instead a simple X-Y pattern can be used. The storage capacity will most likely be sufficient anyway. 2 TB should be enough to cover the English Wikipedia without history and with images sizes actually used. As mentioned earlier, 10x10 µm groves on a 4x4 cm platter will accommodate this. Bytesock (talk) 20:07, 22 April 2016 (UTC)
- @Tonystewart14:A Blu-Ray M-DISC would probably handle space. But to read it back later. A slowly rotating reader will have to be used to avoid shattering the plastics that makes up the disc. As specified, 25 kGy will brittle it. So average interplanetary radiation will probably brittle it in 28 000 years and solar particle events will brittle it in 14 000 years if the moon gets hit everytime, earth dodged one in 2012. So the disc could be done for in 9000 years when combining the radiation sources to a total dose. Regardless, in space everything must handle radiation, rapid temperature swings, micrometeorites etc or perish. So it's a good idea to take these things into account from the start. A Kevlar covering could handle both micrometeorites and dust. I think the one thing that people miss about M-DISC is that the data layer is more resistant to degradation, but the bulk still contains plastic and the metal foil is really thin. Bytesock (talk) 20:07, 22 April 2016 (UTC)
- @Michael Jahn WMDE: I think it has been tested to some extent, just not in full capacity. But then they've already been encoding the Bible and Magna Carta into it, so there it should be reasonable to assume that the data could be retrieved. The problem, then, is really not with the disc, but with the drive that reads it. Radiation is unavoidable but it can be solved. Besides, why don't we go to the dark side of the moon :) Those glass discs can withstand 190°C temperatures, which of course isn't that much related to radiation but just for your information. The Average Wikipedian (talk) 01:43, 23 April 2016 (UTC)
- @Tonystewart14 and Bytesock: Will get back to you with more details, when I get them! As @Nil Einne: has pointed out, the working hypothesis is the 20 GB version, but indeed not for a lack of possible alternatives, simply for the care with which everything in the project needs to be planned. Also, I agree with you @The Average Wikipedian: Thinking about how to/which device to read the data with is crucial. The more you think about these questions, the more sub-challenges you discover: format, "read me"/instructions", message you want to leave behind with the content – which, in my personal opinion, does make the sorting task really interesting. --Michael Jahn WMDE (talk) 06:49, 25 April 2016 (UTC)
- @Michael Jahn WMDE: I think it has been tested to some extent, just not in full capacity. But then they've already been encoding the Bible and Magna Carta into it, so there it should be reasonable to assume that the data could be retrieved. The problem, then, is really not with the disc, but with the drive that reads it. Radiation is unavoidable but it can be solved. Besides, why don't we go to the dark side of the moon :) Those glass discs can withstand 190°C temperatures, which of course isn't that much related to radiation but just for your information. The Average Wikipedian (talk) 01:43, 23 April 2016 (UTC)
- @Tonystewart14:A Blu-Ray M-DISC would probably handle space. But to read it back later. A slowly rotating reader will have to be used to avoid shattering the plastics that makes up the disc. As specified, 25 kGy will brittle it. So average interplanetary radiation will probably brittle it in 28 000 years and solar particle events will brittle it in 14 000 years if the moon gets hit everytime, earth dodged one in 2012. So the disc could be done for in 9000 years when combining the radiation sources to a total dose. Regardless, in space everything must handle radiation, rapid temperature swings, micrometeorites etc or perish. So it's a good idea to take these things into account from the start. A Kevlar covering could handle both micrometeorites and dust. I think the one thing that people miss about M-DISC is that the data layer is more resistant to degradation, but the bulk still contains plastic and the metal foil is really thin. Bytesock (talk) 20:07, 22 April 2016 (UTC)
The right storage media
[edit]I think the only persistent media is acid-free paper. I think we should send the output from Print Wikipedia to the moon.--79.242.198.97 07:55, 22 April 2016 (UTC)
- I agree. We could get, I dunno, about 180 thousand miles of paper and print it out, and maybe if you had a ladder and some glasses, we could see to Hackney marshes, if it wasn't for the houses in between. SimonTrew (talk) 08:05, 22 April 2016 (UTC)
- Etching on copper is usually quite stable, in space, without the action of oxygen to make it verdigris. Do you have a big roll, about 250,000 km, of copper handy? I know how to do it, I worked at a cable making factory for a long time. Getting you the 250,000 km of tinned annealed copper is a fairly easy and I could do that, as a favour, and you can etch it after. The tricky bit is usually in a cable you have a year stamp on it and what year would we possibly put it to? SimonTrew (talk) 08:44, 22 April 2016 (UTC)
- You say media and I say medium. Shall we call the whole thing off? (smiles) SimonTrew (talk) 08:46, 22 April 2016 (UTC)
What about a flash drive?
- It becomes fried in space. Bytesock (talk) 19:13, 22 April 2016 (UTC)
What is this? A time capsule?
[edit]I seriously doubt this project can be useful at all. It feels like a development of the idea of time capsules!--Reem Al-Kashif (talk) 07:59, 22 April 2016 (UTC)
- Probably. Perhaps they want to make a en:The Hitch-Hiker's Guide to the Galaxy, which it already is. en:Mostly harmless. SimonTrew (talk) 08:03, 22 April 2016 (UTC)
- Well nobody went to get the American flag off the moon, the one they put there in 1969, and cleaned up their dirty great footprints and their golfballs.
- The discs sent into space are half american and half british, or european. One is now out of orbit having been launched in 1974 I think and just losing contact with about as much energy that you have in your mobile phone, poor thing. Perhaps I should start a campaign to send Jimbo Wales into space, I am sure he would laugh at it. The most ridiculous, stupid, idea I have ever heard. It says on Wikipedia's vision "Imagine if everone, in the whole world, could have access to any information that they could possibly get". I will go for that one but not the Moon. It explicitly says "in the world".
- Because of the incredible bravery and intelligence of the astronauts., we do clever things with the moon, we bounce signals off of a mirrosr set on the moon to take our time from the difference between the earth's and the moon's orbit, astonishing accomplishments.\
- But I'd rather say hello to it on a dark night than go there, I have no religion but I'd prefer it to be up there than trying to reach it, and polluting it again with Wikipedia nonsense. There are international treaties for what you can pollute a planet with. It is a ridculous, stupid, stupid, idea. Who thought it? The banner do not say. SimonTrew (talk) 08:11, 22 April 2016 (UTC)
- Are you suggesting that a collection of encyclopedic articles is just as valuable as an archaeological find as an abstract flag with stars and stripes? If I'm an archaeologist of the 2500s, I know which one I'd prefer. That, and, you know, it's just a disc on some rover that barely weighs a thing. People bring guitars and golf balls to space, I don't see why a disc is suddenly an issue. The rover will be there either way, so you can either make it more interesting or make it just like every other rover we leave on the moon. Maplestrip (talk) 08:22, 22 April 2016 (UTC)
- I'm not really suggesting that at all, quite the opposite. Wikipedia is stored somewhere and neither you nor I know where, we can't pin it down and say "this is the encomoum of Human knowledge". The magic of the internet means that many people on this planet can look up the fifth most popular site in the world if they don't know a brass monkey from a billhook. I have no idea how you are going to take those billions of edits and put them on the moon. And it would be unfair to readers to do so, the far greater number of people who use and read our hard work but are never credited for "this reader is intelligent, he learned something". How could you possibly credit all the billions of readers who come here? They make the project as good as the editors, it is them who we work for, sometimes they turn into editors, many make small edits anonymously to make the encyclopaedia better. This is literally gazing at the moon, it is a stupid idea. Keep it on Earth, I say. SimonTrew (talk) 08:30, 22 April 2016 (UTC)
- I'm suggesting there is no need of a time capsule because the Wikimedia servers hold that. The junk they store it on, no doubt they will replace it, over time. That is what we pay the Wikimedia Foundation for each Christmas when they ask (well I do). I do not pay the Wikimedia Foundation for loopy ideas such as this. They don't pay me for my thousands of edits and translations and so on either, that's the idea. This seems totally against the Wikipedia vision; if you want to modify the vision so it says "the Enyclopaedia that any Lunarian or Martian can edit", then do so. SimonTrew (talk) 08:36, 22 April 2016 (UTC)
- So if I understand correctly, you'd be fine if, if the internet would get destroyed somehow, Wikipedia would go with it? Also, I still don't really see an argument not to compile a disc for these guys. Like, I understand that a few grams of extra weight costs a lot of fuel, and I hate that, but compared to the other stuff we sent to the moon, this one seems by far the most logical. I'd hate just saying "no" to these guys for no real reason; it would feel like trying to argue that Wikipedia isn't valuable enough to be sent to the moon, which sounds like pretty bad PR to me. Maplestrip (talk) 08:42, 22 April 2016 (UTC)
- (Can you please stop editing so much - I keep getting conflicts :s) – From what I understand, Wikimedia doesn't have much to do with this anymore. This just sounds like another community project with no money involved. I don't care if you donate to the Wikimedia foundation, I just find it cool that these astronomers are giving us this opportunity. Maplestrip (talk) 08:42, 22 April 2016 (UTC)
- Quicjly I tend to make many small edits than large ones. I say this so you are not offended, I hope. I will read yours and reply shortly (if I'm allowed!). No bad faith on either side. SimonTrew (talk) 08:52, 22 April 2016 (UTC)
- Yes, I am setting out my stall thus. The Internet exists, has done since before the Moon landings (as Arpanet, but I don't think it was used in any way for the moon landings), and is indeed ephemeral in any of its current form, it will change. We don't know where the bits and bytes that I or Maplestrip reads are actually stored. They're in a server bank in Atlanta, Georgia or something. I absolutely agree that in case of fire or nuclear war it would be nice to have the "sum of all human knowledge", our goal, kept there, but the Library of Alexandria might be an example of why not to do that (Greeks up to their naaught business again.) I absolutely agree that we should preserve the sum of knowledge as we know right now with all its faults, but I don't think sending it to the moon is the right way to do it. Everyone has a table their grandfather made or an old crappy shirt you would throw away if your mum let you. It comes down really to what is notable. Nobody has had anythign to say on what we put on the disc or what we do not. If someone says take the whole lot, I'd agree to that, but you can't take just what it looks like today, you have to take the whole lot. SimonTrew (talk) 08:59, 22 April 2016 (UTC)
- There's many reasons Wikipedia could become unavailable. Legal demands or laws can make meaningful access hard, and has impacted access in some countries. Power blackouts can render the network and server unavailable. Solar storms can fry the grid. Diseases can put the country into chaos. The board could take an unsuitable direction. Conflict can arise that makes network access intermittent. In other words, it doesn't have to be so Hollywood like to make Wikipedia access unworkable. If you have a backup, then it's not such a big problem. Forks would pop up everywhere. Bytesock (talk) 19:09, 22 April 2016 (UTC)
- Yes. It's exactly a time capsule.
- That is the whole point. It says so clearly and unambiguously. The bold type at the very top of the page describes it as "the ultimate time capsule "
- You say that like it's a bad thing. In my experience people love time capsules. ApLundell (talk) 03:57, 23 April 2016 (UTC)
The people who suggested this idea have smaller plans for it, but what I'm thinking is that it is a time capsule for beyond the end of history. Presumably, humanity will not get global warming under control. The methane clathrates and permafrost become unstable and drive the planet to such a high temperature that the water vapor in the atmosphere starts a positive feedback loop. The oceans will boil, and the increase in overall temperature will eventually make the planetary crust unstable, causing it to be completely overturned and resurfaced like Venus was somewhere within the past billion years. As a result, there will be no artifacts on Earth to be studied. Therefore, we provide those who come after (long after) with a quartz disc with a putative 13.8 billion year lifetime, and hopefully some aspect of the landing, such as rare elements in the lander, will tend to mark its position to curious explorers. In this way a great deal of information about Earth will be put into their possession that otherwise is essentially unavailable to them, despite all their technology. Wnt (talk) 20:39, 26 April 2016 (UTC)
Good idea!
[edit]Why do you stayed edge of 20 GB? 1 Blue Ray disc can include 70-80 GB. 1 HDD can include 6-7-8-more TB! Maybe, HDD is too big and heavy to the space machine? Use TransFlash! One MicroSD card can include 200 GB data; if you use some MicroSDs with weight equal to 1 Blue Ray Disc, they could include over terabyte of Wikipedias, it can include ALL linguistic parts of WP! (sorry for my en) Фред-Продавец звёзд (talk) 10:51, 22 April 2016 (UTC)
- Technological limitations. Well, to be more accurate: space technological limitations. Any flash drive would apparently be fried in space due to the radiation. In general, we would want something that would last for a while; something we could ideally retrieve one day. I do not know what the most effective kind of disc would be, but this is being discussed in a section above somewhere. ~Mable (chat) 10:54, 22 April 2016 (UTC)
- That's right! --Michael Jahn WMDE (talk) 06:52, 25 April 2016 (UTC)
Translating the banner
[edit]Hi,
Can the central notice banner be made translatable as soon as possible?
Currently it is shown in English to all the logged-in users in all the wikis, and English is a language that most people don't know. What's even worse, in right-to-left wikis it appears especially broken.
Pinging Martin, in particular.
Thank you! --Amir E. Aharoni (talk) 12:27, 22 April 2016 (UTC)
Support I agree, if a banner is shown on non-English Wikipedia, it shall be in that wiki's language, hence it shall be translatable, and at least it should ask for translation when the campaign started. Kenrick95 (talk) 15:45, 22 April 2016 (UTC)
Support Yes, please make it translatable. --Lsanabria (talk) 17:27, 22 April 2016 (UTC)
Done, though I guess Amire80 could actually do it too :) --Base (talk) 18:50, 22 April 2016 (UTC)
Best of Luck
[edit]Best of Luck to all from Christian Madhesis from Nepal. Damakian (talk) 13:43, 22 April 2016 (UTC)
Oh come on
[edit]Humans are nototious throughout the Galaxy for pointless symbolic actions.--Zofo (talk) 13:53, 22 April 2016 (UTC)
Voting
[edit]We seriously need voting now. Clearly, editors are not liking this idea. At this time, Lionel Messi has five Ballon d'Or awards. By the time it would reach moon, there will be new records. This encyclopedia, as we know, is constantly updated and thus a significant amount of information gets changed. What is the point of sending it to the moon. Just to have a feat that no other website in top ten Alexa rank could do? And why only Wikipedia? Just because that project has most editors? Wikimedia do have other sister projects. Let's have voting. People who want this to happen. People who do not want this to happen.
acagastya ✉ Dicere Aliquid :) 13:53, 22 April 2016 (UTC)
- If the XPRIZE astronomers want to do this; let them. If you don't want the community help them pick the best articles... that's an opinion, I guess? I mean, I like the idea of having a little influence on this. We could just tell them "eh, just choose whatever," but instead we get to actually have some input in this. ~Mable (chat) 14:24, 22 April 2016 (UTC)
- We really do not need to vote on this. This is a voluntary project on a volunteer project so if people don't want to participate it's their decision. I don't personally like the banner, but it's not that big of a deal to X out of it either. It's just not that big of a deal to create a page here on Meta for people to discuss the issue if they want and it makes Wikipedia/Wikimedia a good neighbor to work with them on what articles are best to include. We wouldn't want to be blamed for giving the aliens an edge on our planets defensive capabilities would we? :-) Reguyla (talk) 16:18, 22 April 2016 (UTC)
- If Part Time Scientists wants to put a disk of our articles on the moon, then we don't exactly have the ability to stop them (since we are under the Creative Commons, a license that prohibits us from blocking the re-use of our content). Honestly, I think its nice that we're being given the decision to choose what content goes onto the disk. If anyone thinks this idea is stupid, then they have every right to simply not participate in it. Spirit of Eagle (talk) 17:06, 22 April 2016 (UTC)
- That makes no freaking sense.
acagastya ✉ Dicere Aliquid :) 21:45, 22 April 2016 (UTC)- What aspect of it doesn't make sense? ~Mable (chat) 21:49, 22 April 2016 (UTC)
- This whole attempt does not make a sense. Not only it is pointless: sending some datadisk to crash/land somewhere on the room. It is also not feasible: there is over 99% probability that this thing will not be launched at all (fun fact: launching rockets to the moon requires time, skills and money and the time frame is unrealistic). The whole project is highly vague and, on top of that, it looks like a PR stunt performed by a car brand. I am amazed it went so far. aegis maelstrom δ 22:51, 22 April 2016 (UTC)
- P.S. There is no such a thing as "XPRIZE astronomers"; anyone using such a term does not have a clue about the topic discussed.
- True, I don't. I'm pretty frustrated with how vague everything is right now. I'm surprised you call this point "so far", as we basically got nothing yet. Someone just created what amounts to a thread and a lot of people naturally like the idea from a romantic point of view. However, to me, that seems like the only reason not to help these guys with this idea. Bad communication, bad organization, high chance of failure. But those aren't really reasons to say "let's not look into this at all", are they? ~Mable (chat) 17:37, 23 April 2016 (UTC)
- I would be reluctant to say bad organisation unless you're referring to details elsewhere than here on meta. Bad communication may be fairer. On the other hand, this seems to be a very very minor part of their plan, I guess they came up with various things to fit on (one of?) their discs and found they still had 20GB left and were wondering what else and thought of offering it to Wikimedia Deutschland. There's a fair chance few if any of them have much experience with the wikimedia community so they had little idea of what would happen after, and really why should they? Considering all they would have on their plate, personally I don't think it's that unresonable that they don't have much time to explain why they chose a 25 GB M-DISC etc. It sounds like they have looked in to other things like the 360TB thing people keep talking about. If you meant with the overall project, having briefly looked at the website when this first came up and done some search, I would agree the details can be scant at time. However from the admitedly only small amount I've seen I would be even more reluctant to talk about bad communication solely from that. The very tight time frame left if they want to win the Google X-Prize (unless it's extended again) combined with the competitive nature means that such endevours means it's not that surprising details tend to be slower and scanter than we would like. This doesn't mean I think they're an excellent team, simply that I have insufficient details to comment. They did win some of the milestone prizes (although not the key one). Nil Einne (talk) 18:39, 23 April 2016 (UTC)
- I said "bad organization" because we currently have a dozen "scenarios" up on the page and many of them don't feel realistic or need to be discussed further, but soon we have to vote on them. It all feels rather awkward, and I'd rather have someone "in charge" picking some favorites and transcribing the options into something we can vote on. It's all just kinda messy... ~Mable (chat) 20:44, 23 April 2016 (UTC)
- I would be reluctant to say bad organisation unless you're referring to details elsewhere than here on meta. Bad communication may be fairer. On the other hand, this seems to be a very very minor part of their plan, I guess they came up with various things to fit on (one of?) their discs and found they still had 20GB left and were wondering what else and thought of offering it to Wikimedia Deutschland. There's a fair chance few if any of them have much experience with the wikimedia community so they had little idea of what would happen after, and really why should they? Considering all they would have on their plate, personally I don't think it's that unresonable that they don't have much time to explain why they chose a 25 GB M-DISC etc. It sounds like they have looked in to other things like the 360TB thing people keep talking about. If you meant with the overall project, having briefly looked at the website when this first came up and done some search, I would agree the details can be scant at time. However from the admitedly only small amount I've seen I would be even more reluctant to talk about bad communication solely from that. The very tight time frame left if they want to win the Google X-Prize (unless it's extended again) combined with the competitive nature means that such endevours means it's not that surprising details tend to be slower and scanter than we would like. This doesn't mean I think they're an excellent team, simply that I have insufficient details to comment. They did win some of the milestone prizes (although not the key one). Nil Einne (talk) 18:39, 23 April 2016 (UTC)
- True, I don't. I'm pretty frustrated with how vague everything is right now. I'm surprised you call this point "so far", as we basically got nothing yet. Someone just created what amounts to a thread and a lot of people naturally like the idea from a romantic point of view. However, to me, that seems like the only reason not to help these guys with this idea. Bad communication, bad organization, high chance of failure. But those aren't really reasons to say "let's not look into this at all", are they? ~Mable (chat) 17:37, 23 April 2016 (UTC)
- What aspect of it doesn't make sense? ~Mable (chat) 21:49, 22 April 2016 (UTC)
- That makes no freaking sense.
- If Part Time Scientists wants to put a disk of our articles on the moon, then we don't exactly have the ability to stop them (since we are under the Creative Commons, a license that prohibits us from blocking the re-use of our content). Honestly, I think its nice that we're being given the decision to choose what content goes onto the disk. If anyone thinks this idea is stupid, then they have every right to simply not participate in it. Spirit of Eagle (talk) 17:06, 22 April 2016 (UTC)
- We really do not need to vote on this. This is a voluntary project on a volunteer project so if people don't want to participate it's their decision. I don't personally like the banner, but it's not that big of a deal to X out of it either. It's just not that big of a deal to create a page here on Meta for people to discuss the issue if they want and it makes Wikipedia/Wikimedia a good neighbor to work with them on what articles are best to include. We wouldn't want to be blamed for giving the aliens an edge on our planets defensive capabilities would we? :-) Reguyla (talk) 16:18, 22 April 2016 (UTC)
- You want to vote on whether or not other people should be allowed to do something with their own time and money? ApLundell (talk) 03:52, 23 April 2016 (UTC)
- But this page is not a random community project; it is a central notice, cross-wide leveredged initiative started with not asking other stakeholders! One would think that it may be e.g. unethical to encourage other people, eg. with the central sitenotice, to dedicate their time, minds and encouragement to something highly doubtful and TBH unfeasible. We have hundreds of great and actually more tangible initiatives in the movement where we are not doing this. Additionally, we may face a huge PR backlash.
- I like that people try new things and what to bring something fresh but I think it should have been more discussed and tested before we jump the shark and push to dozens of thousands of people some initiative. aegis maelstrom δ 09:18, 23 April 2016 (UTC)
- I agree, practically there's still quite a high chance the disc won't even successfully make it to the moon (most probably because the project literally never gets of the ground or alternatively because it does but either doesn't make it to the moon or does but in pieces). But it seems to me more so than a number of the other WMF iniatives (and this is closer to the Wikimedia Deutschland anyway for obvious reasons), it's a case of shouldn't waste the time of those who choose not to partipate, so let those who want to partipate do so and the WMF and Wikimedia Deutschland spend their time how they choose. I think a key point is that ultimately it would have to be a longshot. By the time it isn't a longshot, it's way too late. Also I think it's clear that this project is intended to involve people who wouldn't otherwise participate in editing anywhere. How much it will actually achieve that is ultimately very difficult to predict but there are reasons to think it may do so. As for PR backlash, IMO that's only likely to happen because of a community failure (e.g. things get too heated on the selection or the selection comes across as majorly flawed to the world's media or we include serious vandalism particularly personal defamation on the final selection) and I would be reluctant to say we shouldn't do something because we the community is likely to fail. And I say that even though I appreciate that this backlash could easily happen despite nothing significant even coming from our work because the team fails. Nil Einne (talk) 18:39, 23 April 2016 (UTC)
- There's no guarantee that this will work, of course. I only know that people have put years of work into this and they are collaborating closely with space travel professionals. And yes, they have much more on their plate than Wikipedia, which is why I'm so happy about their gift. I've drafted some ideas about the voting process below Preparing_Phase_2:_voting --Michael Jahn WMDE (talk) 13:03, 27 May 2016 (UTC)
- I agree, practically there's still quite a high chance the disc won't even successfully make it to the moon (most probably because the project literally never gets of the ground or alternatively because it does but either doesn't make it to the moon or does but in pieces). But it seems to me more so than a number of the other WMF iniatives (and this is closer to the Wikimedia Deutschland anyway for obvious reasons), it's a case of shouldn't waste the time of those who choose not to partipate, so let those who want to partipate do so and the WMF and Wikimedia Deutschland spend their time how they choose. I think a key point is that ultimately it would have to be a longshot. By the time it isn't a longshot, it's way too late. Also I think it's clear that this project is intended to involve people who wouldn't otherwise participate in editing anywhere. How much it will actually achieve that is ultimately very difficult to predict but there are reasons to think it may do so. As for PR backlash, IMO that's only likely to happen because of a community failure (e.g. things get too heated on the selection or the selection comes across as majorly flawed to the world's media or we include serious vandalism particularly personal defamation on the final selection) and I would be reluctant to say we shouldn't do something because we the community is likely to fail. And I say that even though I appreciate that this backlash could easily happen despite nothing significant even coming from our work because the team fails. Nil Einne (talk) 18:39, 23 April 2016 (UTC)
We don't have enough storage? No!
[edit]Most scenarios focus on what we have to give up in order to maximize the meaning of sending Wikipedia into space. But do we really have to give up everything? Are we really lacking the technology? Answer is: no. Now I'm not sure how much data all Wikimedia projects need, probably a lot, and I noticed that the general 1 TB hard disk is too fragile, heavy and large for the mission. Because this project isn't actually that realistic after all (I mean it's just that scientists want Wikipedia to go to the moon, not that aliens would visit the moon and see the information, and even so they would probably choose the Earth as their first landing spot), I think there is some room for experimentation, just a small gamble. OK I'll get to the point now. We have the technology to put 360 TB of data in a tiny glass disc. If you are a science enthusiast like me you might have heard of the "Five-dimensional glass storage" thing that came out of the University of Southampton this year. This disc utilizes optical data and has been proven to be very stable and durable. It would be a constructive experiment to a) see whether the data can really be stored properly in the disc, and b) test it out in space. I do think that the idea to send Wikipedia to the Moon is more of a symbolic project than something of practical use. Anyhow, these chips can survive for as long as the observable universe has been. If it works, it would be the next technological milestone for humans because it means that we now have the technology to transmit information from Earth via these discs during interstellar travels. At the end of the day the disc is so small that you would probably still have some room left for a backup conventional disc if necessary. The Average Wikipedian (talk) 14:04, 22 April 2016 (UTC)
- There's a section above titled "Real non-volatile storage that can handle space radiation" on this topic. Do give your input there. ~Mable (chat) 14:25, 22 April 2016 (UTC)
Compression and data format
[edit]Hello. Can we use compression to improve the capacity or it is allowed only 20 GB of uncompressed plain text? Can we include audio or video in the disc? How is the disc played? Emijrp (talk) 15:09, 22 April 2016 (UTC)
- I hope that many of these questions could be answered in the section "Technical unclearities" above. Either way, I believe audio and video are an option, though they may not be efficient. I'd rather get ten more articles than five seconds of audio. I don't know the actual numbers. ~Mable (chat) 17:14, 22 April 2016 (UTC)
Why only one disc?
[edit]Would more disc space really be too much to ask? They are small and lightweight.
- Because they happen to have some disc space left and like to use it for something, but have little interest in paying money to get even more disc space they don't technically need. ~Mable (chat) 19:09, 22 April 2016 (UTC)
- The team were actually letting people pay to add payload but I think that has past as they're now in qualification and testing however it's possible that is only for active payload [5] [6]. Either way though, unless you're willing to pay several hundred thousand per kg, yes it is probably too much to ask. The team have their own goals and plans, they decided on the disc and decided offer some data or a whole disc (I'm somewhat confused which). If you have good understanding of how you may be able to achieve long term archiving in space including on the surface of the moon and confident your proposal could be implemented in a few months, perhaps it's not too late to approach the team with an alternative proposal of storage medium. Otherwise it's probably not worth discussing. Nil Einne (talk) 17:38, 23 April 2016 (UTC)
- For clarity: it seems to me that 5 GB of the disc is in use, and 20 GB of the disc is unused. The team thought it would be a neat idea to put some Wikipedia articles in there and asked us for help. ~Mable (chat) 17:42, 23 April 2016 (UTC)
- Yes I just read the above confirming it was an M-DISC. The about page still suggests it's only one of multiple discs Wikipedia to the Moon/About "special data discs that are made of ceramic. Having been great Wikipedia fans for years, the Part-Time Scientists are offering Wikimedia Deutschland the chance to use one of the discs for Wikipedia content". But it could be misleading or maybe it's right so it's a substanial part of one of several discs. There are also lots of other things including commercial projects that could be included so multiple discs isn't that surprising. Nil Einne (talk) 17:46, 23 April 2016 (UTC)
- For clarity: it seems to me that 5 GB of the disc is in use, and 20 GB of the disc is unused. The team thought it would be a neat idea to put some Wikipedia articles in there and asked us for help. ~Mable (chat) 17:42, 23 April 2016 (UTC)
- The team were actually letting people pay to add payload but I think that has past as they're now in qualification and testing however it's possible that is only for active payload [5] [6]. Either way though, unless you're willing to pay several hundred thousand per kg, yes it is probably too much to ask. The team have their own goals and plans, they decided on the disc and decided offer some data or a whole disc (I'm somewhat confused which). If you have good understanding of how you may be able to achieve long term archiving in space including on the surface of the moon and confident your proposal could be implemented in a few months, perhaps it's not too late to approach the team with an alternative proposal of storage medium. Otherwise it's probably not worth discussing. Nil Einne (talk) 17:38, 23 April 2016 (UTC)
I have been thinking about this, the limited data space. And I propose to split Wiki[pm]edia content in several 20 GB discs and put in the rover just the Volume I (which could include a full index by the way). The following volumes could be stored in national libraries worldwide. We should include the locations (coordinates) for all volumes in the Volume I. My two cents. Emijrp (talk) 08:48, 25 April 2016 (UTC)
Is it really Wikipedia that we talk of going to the moon?
[edit]In my view Wikipadia is a living entity, and it can not be sent to the moon. What could be sent is a copy of the data that existed in Wikipedia a certain date, but it should be treated like an archive/mirror site. It could be called Moonpedia but I do not approve it being called Wikipedia: I am a contributer and see myslef as a owner of the real Wikipadia, and see calling the thing to be sent to the moon "Wikipedia" as an infringement of "my" brand.Yger (talk) 19:15, 22 April 2016 (UTC)
- Wikipedia articles to the Moon. As in, Wikipedia articles as they exist at the moment. I like the idea of calling it "Moonpedia", but I'd rather use that term when we actually have an editable version of Wikipedia up there. These are just some static Wikipedia articles. It's similar to "printing Wikipedia out" and turning Wikipedia in a book. Is that also infringing on "your brand"? I mean, not like you actually own Wikipedia. These astronomers "own" it just as much, and are allowed to do with it as they like. ~Mable (chat) 21:11, 22 April 2016 (UTC)
- There already exist offline copies using the Wikipedia name. (Incidentally, if you're going to complain about what you feel is a misuse of a name, maybe try to spell it correctly?) ApLundell (talk) 03:51, 23 April 2016 (UTC)
- If you do not change the wording "to take Wikipedia to the moon" I intend to take this issue to WMF legal, as I do think this is a misuse of the brand. The copy of the text you discuss to take to the moon, is not to be named Wikipedia. And to attack me as a person for my dyslexia does not impress me for the fact issue. Yger (talk) 05:41, 23 April 2016 (UTC)
- Good luck suing the WMF over their own trademark which you have no legal right to and over something which has happened many times before (using of the trademark to refer to offline or other such copies). Nil Einne (talk) 17:26, 23 April 2016 (UTC)
- I have no thought to sue WMF, just for them to tell clerly that this inititive is misusing the name Wikipedia.Yger (talk) 11:13, 24 April 2016 (UTC)
- I'll rephrase. Good luck complaining to the WMF that they are misusing their own trademark which you have no right to and over something which has happened many times before. Nil Einne (talk) 03:55, 27 April 2016 (UTC)
- I have no thought to sue WMF, just for them to tell clerly that this inititive is misusing the name Wikipedia.Yger (talk) 11:13, 24 April 2016 (UTC)
- Good luck suing the WMF over their own trademark which you have no legal right to and over something which has happened many times before (using of the trademark to refer to offline or other such copies). Nil Einne (talk) 17:26, 23 April 2016 (UTC)
- If you do not change the wording "to take Wikipedia to the moon" I intend to take this issue to WMF legal, as I do think this is a misuse of the brand. The copy of the text you discuss to take to the moon, is not to be named Wikipedia. And to attack me as a person for my dyslexia does not impress me for the fact issue. Yger (talk) 05:41, 23 April 2016 (UTC)
This seems quite pompous
[edit]That amidst the scientific equipment and rover structure, i.e. the pieces actually doing something, that a lasting commemorative of this project would be to include a disk of articles from a website that happened to be popular at the time of the mission. In a few centuries, once Wikipedia has long since gone off-line and been forgotten on Earth, will we have future visitors to the Moon reading a plaque pointing out a relic from a past that was a "neat idea" at the time? I see this as sort of the equivalent of sending a 1968 World Book volume on Apollo 11. Dralwik (talk) 21:28, 22 April 2016 (UTC)
- Is it weird to send an encyclopedia of human knowledge to the moon? I mean, Wikipedia is known to be free and more accurate than many contemporary encyclopedias. If you want to send up a large collection of information, going with an established encyclopedia seems logical. If I were an archaeologist, I'd be pretty happy with finding a 300-year old encyclopedia no matter what the brand. ~Mable (chat) 21:42, 22 April 2016 (UTC)
- If something is popular now, and you expect it to be forgotten in "a few centuries", then it is, almost by definition, the perfect choice for putting in a time capsule. ApLundell (talk) 03:58, 23 April 2016 (UTC)
- The fact that it will some-day be gone makes it worth putting up there. As the others here have mentioned, it will be an interesting snapshot of how we obtain and use information at this time in history. Ajraddatz (talk) 07:25, 21 May 2016 (UTC)
Help
[edit]Ive tried to add a scenario a billion times, but it has failed every time, now my scenario is a seperate section. Any help?
MakeMeDo (talk) 16:32, 23 April 2016 (UTC)
- Yes, the [edit] links don't work :-/ I don't know if it is related to the translation tags or what. Meanwhile, I have open a subpage in English Wikipedia for my views on this project: en:User:Emijrp/Wikipedia to the Moon. I am still improving it. Emijrp (talk) 08:41, 24 April 2016 (UTC)
- Yes, it's the translation tags. You might be able to create a full URL that will have the effect that you want, or to do clever things with transclusion to get around it. WhatamIdoing (talk) 21:16, 24 April 2016 (UTC)
Selecting articles by quality
[edit]You may want to look into Objective Revision Evaluation Service#Article quality models as a method for screening potential articles. It's available in several languages, and the w:en:WP:1.0 assessments for some subject areas are probably out of date. WhatamIdoing (talk) 21:14, 24 April 2016 (UTC)
- Why not simply select all the Featured Articles and Good Articles on every wiki? They'd fit on the disk, surely. Chiswick Chap (talk) 18:11, 25 April 2016 (UTC)
Technical unclearities
[edit]Regarding storing the data, there's some unclearaties:
- Should the data be compressed? if so what format? how will the format be documented to someone that can't read any language that is presently used? or have any similar reference frame.
- Store a few articles both as compressed and uncompressed to give a clue on the compression algorithm being used?
- Any assumptions on computer capacity?
- Will wikisyntax or html be used?
- Present a rendered bitmap picture to clue in on how the data is to be rendered?
- Documentation on ASCII, instruction sets for CPUs, how program code is interpreted etc? or what words mean?
- Documentation on on formats for JPEG etc?
- Documentation on line code used to relate groves etc to actual bits?
- What container format should be used?
- Index?
- Case in point, our DNA consists of about 763 MB of data. We still can't read and understand it. The same was true for a long time of the hieroglyphs until the Rosetta stone was found. Dolphins have a language too, we still can't get any depth of understanding in it.
- Will the storage material become brittle from radiation such that it would shatter upon any later attempt to read it?
- Should some or all articles be stored as directly readable bitmaps with a microscope or as stored data like on a cd-rom?
Bytesock (talk) 18:54, 21 April 2016 (UTC)
- I agree, there should be something physical like the Rosetta Stone that instructs a user on how to convert binary into HTML including any decompression. Tonystewart14 (talk) 03:54, 22 April 2016 (UTC)
- Agree as well, how to read it is quite important, to do no let the information become useless to anyone who will found out. Instead of html it could be in txt and at the beginning of the file, to add "how to binary works", but i guess if they could make his way to the moon, so perhaps they already have a way to understand and translate binary into his own.--SinglePlayer (talk) 17:53, 22 April 2016 (UTC)
Data size
[edit]How much space does current version of Wikipedia text + image size actually used in articles take? ie only using those images that are present in articles and only in the size they are used. Bytesock (talk) 21:20, 21 April 2016 (UTC)
- In the first section about Kiwix, a user said that for all languages without images it comes out to 47 GB. With images, I'd guess it would be around 150 GB. Tonystewart14 (talk) 02:24, 22 April 2016 (UTC)
Specifics on ceramic disc?
[edit]Does anyone have a link or details on specifics of the ceramic disc besides that it's ceramic and holds 20 GB? The closest I could find is M-DISC, which is similar but is more of a durable Blu-ray than actual ceramic. If M-DISC would work, however, there might be a chance of using a 100 GB disc instead of 20. Tonystewart14 (talk) 22:02, 21 April 2016 (UTC)
- My idea is to use the 100 GB disc and use half the space for Wikipedia in all languages without images, and half with Project Gutenberg. This should total to 92 GB (47 and 45 GB, respectively). Tonystewart14 (talk) 04:05, 22 April 2016 (UTC)
- It is an M-Disc, you're right @Tonystewart14: Michael Jahn WMDE (talk) 06:50, 22 April 2016 (UTC)
- @Michael Jahn WMDE: Thank you for clarifying. However, is there any reason it couldn't be 100 GB? It appears that you may have just been using the standard 25 GB Blu-ray disc, not the multi-layer 100 GB one. Tonystewart14 (talk) 07:06, 22 April 2016 (UTC)
- I can answer that: The 25 GB disc has been tested and qualifies for use in space. That's why the Part-Time Scientists decided to go with that one. Reliability is key. The 100 GB is relatively new and hasn't been officially tested. It might work just as well, of course, and the manufacturer says so. However, the team doesn't want to promise disc space that they cannot guarantee they can give. --Michael Jahn WMDE (talk) 18:08, 22 April 2016 (UTC)
- Thanks for that. We have several months left, so perhaps we could do some independent testing using the same methods if it's not too expensive and see if the 100 GB disc holds up as well. Tonystewart14 (talk) 00:16, 23 April 2016 (UTC)
- I can answer that: The 25 GB disc has been tested and qualifies for use in space. That's why the Part-Time Scientists decided to go with that one. Reliability is key. The 100 GB is relatively new and hasn't been officially tested. It might work just as well, of course, and the manufacturer says so. However, the team doesn't want to promise disc space that they cannot guarantee they can give. --Michael Jahn WMDE (talk) 18:08, 22 April 2016 (UTC)
- @Michael Jahn WMDE: Thank you for clarifying. However, is there any reason it couldn't be 100 GB? It appears that you may have just been using the standard 25 GB Blu-ray disc, not the multi-layer 100 GB one. Tonystewart14 (talk) 07:06, 22 April 2016 (UTC)
- It is an M-Disc, you're right @Tonystewart14: Michael Jahn WMDE (talk) 06:50, 22 April 2016 (UTC)
The Southampton optical disc 360 TB is a no brainer, really
[edit]After some thinking, the Southampton optical disc that can take 360 TB and that uses less physical space than any standard CD, DVD, or BluRay disc seems like a no-brainer. It will save Wikipedians from selecting articles, provide a backup and allow the space project to save volume and weight. Southampton university or the commercial off-spin can get free product placement and Wikipedia can get access to a superior storage media. The capacity can be reduced to make read operation easier. There's also another use, and that is to enable a lot of people to have their own personal copy of the whole Wikipedia in an economically sustainable way. And may also provide a way for Wikipedia to get donations by selling such glass discs. Getting something tangible and with practical use will for sure motivate people a lot more to spend money. Bytesock (talk) 18:05, 25 April 2016 (UTC)
- It's a no brainer assuming that it can be provided to the team. It certainly makes sense as a win-win scenario to allow Southampton additional marketing potential as well as give us much more storage space. Whether it can actually come to fruition, however, is another question.
- From the article, it mentions some examples of small files being written to it, but not anywhere near 360 TB on one disc. So I'm not sure if that's just theoretical or if it has been demonstrated at that capacity. Perhaps one of us should reach out to the university to see if they believe that they could burn one for us by the end of 2016 given that we provide them with the data on a NAS or other device. Tonystewart14 (talk) 07:07, 26 April 2016 (UTC)
- Yes beyond the issue of the fact that the longevitiy is significantly more theoretical than an M-DISC, there's the open question of what's actually been demonstrated with the Wikipedia:Superman memory crystal. The first thought is whether readback has even been demonstrated. [7] suggests it has although only with an optical microscope.
And note, that's from 2013. There's the question of what has been achieved since then, in particular what the 2016 PR was all about (well other than PR). From [8] it seems there has been some longevity testing (which was published in 2014) but I guess there has been something more, however I'm not sure what. In particular the 360TB claims seem to be based on densities. Notably if I'm understanding the 2016 article correctly, I'm not even sure these densities have been demonstrated or they are just theoretical if they change their laser setup. Similarly for writing a whole disc. Perhaps there is more in the conference proceedings and if PTS have reached out to the team they probably have a better idea.
But it seems to me it's easily possible producing such a disc in the tight time frames may not be practical. As for producing lots of them, well if you pay enough I'm sure you could do it, but I suspect you may be underestimating how much it's likely to cost. I doubt access to a femtosecond laser and their research setup is cheap. Publicity is good but in itself it doesn't pay the bills. How many people are going to be willing to pay for a US$5000 copy of wikipedia? (Random cost.) Especially considering if yoy're talking about a capacity of 2TB, by the end of next year you can probably get an SSD with wikipedia for US$200. Sure it not suitable for space, and won't last anywhere near as long however you can at least read it and more importantly if it's symbolism, the less special what you're buying is the less interesting it is.
Also I fairly doubt it's that easy to change recording technique completely to not be 5-D. Especially in the tight time frames. And there's a fair chance it's not something the research team is going to be interested in it.
This doesn't mean the general idea isn't worth exploring, but ultimately as I said above and elsewhere, it's PTS's decision and they seem to be exploring it but the 20GB on an M-DISC is what we should plan around. (And as I said elsewhere and others have also indicated, while this particular example is somewhat rarer in that they advertise both high longevity and high capacity, if you've been around for long enough you now how frequent claims of revolutionary storage technologies are.)
- Yes beyond the issue of the fact that the longevitiy is significantly more theoretical than an M-DISC, there's the open question of what's actually been demonstrated with the Wikipedia:Superman memory crystal. The first thought is whether readback has even been demonstrated. [7] suggests it has although only with an optical microscope.
- The 5D optical storage uses 3-layers, blob size, and orientation to encode in 5 dimensions, or rather modulation methods. To go into a simple 2D version is the matter of not using some of the capabilities. And that would perhaps give 30 TB. How the "orientation" encoding works is slightly unclear. Same goes for what is meant by nanostructured glass. Getting a lab setup for a femtolaser and positioning mechanism is surely hard. But that is exactly what they have already accomplished. Making another run is less of an issue. So it's about using existing methods with an existing setup. The cost is going to be high in the development stage but that is usually what the R&D budget already covers. To use it as a commercial backup, the price has to come down and that means automated volume and Wikipedia can be a way to prove that the technique is viable. So the additional cost for a Wikipedia disc would be employee time and the material. Probably not that expensive. Writing speed might however be. The general method of writing using a power laser into glass or metals like wolfram isn't that new so there might be other providers for this. Perhaps it's even possible to build something for less equipped persons. I think Wikipedia should at least make some official inquiries to look into optical storage. Bytesock (talk) 12:18, 27 April 2016 (UTC)
Thank you for following up on my idea
[edit]Hi everyone and @Emijrp: @Martin Rulsch (WMDE): @Maplestrip:, Thank you for using my idea to send Wikipedia into outer space. In the Idea Grant page, there is a discussion of the relative merits on what to send. Originally, I proposed to sent the kid safe version because it was curated and edited already.
- Use the preexisting copy of WikiOffline for the curated and profanity-free versions of Good Articles (or Extract the good articles of Wikipedia and WikiCommons and place on storage medium). Please see the Wikipedia offline team and their idea page about the OpenZIM files.
This version of the outer space project in 2015:
https://meta.wikimedia.org/wiki/Grants:IEG/Wikipedia_likes_Galactic_Exploration_for_Posterity_2015
See [9] for a past version.
My best regards, Geraldshields11 (talk) 01:26, 27 April 2016 (UTC)
- It's nice to see this and the WP 1.0 project taking off again. This will be good not only for this project, but for schools around the world and anywhere else that could use an offline, curated version of Wikipedia. Tonystewart14 (talk) 03:33, 4 May 2016 (UTC)
- Dear @GlamChem:, @Ipigott: @N2e: , @Tonystewart14: Thank you for your support on putting Wikipedia into outer space. Geraldshields11 (talk) 13:18, 4 May 2016 (UTC)
- Dear @Turle:, Sorry for not responding for so long. I was focusing on getting partners with space launch capabilities so I could piggy back on their ride. It now seems the German chapter is likely able to piggy back on a launch]. I am so excited and happy at this. Geraldshields11 (talk) 13:25, 4 May 2016 (UTC)
- Dear Michael Jahn WMDE Some of the ideas about what to put on the discs are discussed at the talk page of my idea. Geraldshields11 (talk) 00:35, 7 May 2016 (UTC)
Dealing with ineffective scenarios
[edit](Post by Maplestrip (Mable))
Scenarios to scrap
[edit]A few scenarios currently listed don't have a basis in realism or wouldn't be effective time-wise. I am talking about:
- Use an SD card and Don't decide, which suggest a change in hardware. Though this is definitely something to suggest to the team, this scenario doesn't seem useful to consider compared to the other scenarios. I'm fine with someone starting a project in collaboration with the team to get them a better storage device, but they would have to start doing that now. In case this idea doesn't come to fruition (which is possible for various reasons), let us discuss what we're going to do with the 20 gigs we are actually offered. If we wait to suggest a change of hardware until July 1st, we're already much too late.
- Moved to section below.
- One step back first, take care about the aim is the kind of thing we are currently doing on this very talk page. Everyone has their own ideas of what the aim of this initiative is, and we are discussing why we are taking this opportunity on these pages. Again, we can't wait until July 1st and then completely restart the project because we suddenly have consensus about the "aim" of the initiative. We're on a deadline.
- A Wikipedia canon doesn't seem to suggest anything new. Isn't this discussion we're having on these pages a collaboration of all Wikipedias (albeit held in English) about what kind of articles we will send? Again, this option seems to suggest that we won't properly decide which articles we will send until after July 1st. The "Top 30" idea that follows it may be considered a more specifically worded version of this idea.
- Ah, maybe the wording wasn't clear enough in the basic idea: There is a substantial difference between the canon idea and the Top 30 idea. The canon is (was) meant to consitute 1 set of articles, which would then be translated to all languages (where necessary, i. e. missing) and improved, whereas the TOP 30 leave canonization to the single language version communities, with up to 300 sets of TOP 30 articles, that would then only be collected but not translated. Hope this helps! --Michael Jahn WMDE (talk) 08:03, 9 May 2016 (UTC)
- That makes more sense. The thing I'm primarily concerned about is how this "1 set of articles" would be chosen. The rest of the idea seems pretty solid. ~Mable (chat) 08:16, 9 May 2016 (UTC)
- Yes, that'd be the hard part. That's why the working phase is so long (in any scenario). Imagine that this ends up with a decision to build the canon, then the first weeks after the decision would probably need to tackle how to actually do that – before assembling and working on article themselves could take place. I feel that it's very bold, this canon thing. But then again, so is collecting 100+ "little canons" (Top 30's). --Michael Jahn WMDE (talk) 17:02, 11 May 2016 (UTC)
- That makes more sense. The thing I'm primarily concerned about is how this "1 set of articles" would be chosen. The rest of the idea seems pretty solid. ~Mable (chat) 08:16, 9 May 2016 (UTC)
- Ah, maybe the wording wasn't clear enough in the basic idea: There is a substantial difference between the canon idea and the Top 30 idea. The canon is (was) meant to consitute 1 set of articles, which would then be translated to all languages (where necessary, i. e. missing) and improved, whereas the TOP 30 leave canonization to the single language version communities, with up to 300 sets of TOP 30 articles, that would then only be collected but not translated. Hope this helps! --Michael Jahn WMDE (talk) 08:03, 9 May 2016 (UTC)
I believe all these options should be scrapped from the scenarios list before the voting phase begins, lest people will be confused about what is going to happen in the working phase. I'd like some input; perhaps the "canon" could be edited to be more specific. I don't think there is much possibility for saving them, though. ~Mable (chat) 07:22, 9 May 2016 (UTC)
- If it's useful to avoid confusion, some pre-voting clear-up and/or merging might be practical, yes. It's a thin line, though, but at some point some edits to the list seem wise. --Michael Jahn WMDE (talk) 08:03, 9 May 2016 (UTC)
Seeing as no one is defending these entries, shall I move "Use an SD card" and "Don't decide" and "One step back" to the talk page, cleaning up the scenario page? ~Mable (chat) 08:48, 12 May 2016 (UTC)
Scenarios to edit
[edit]Other scenarios also have issues, though they may have some practical use. I think the following scenarios need to be improved so that people will actually know what will happen if they are voted on:
- Language agnostic too doesn't suggest how to pick articles, and would need to be "combined" with another option (such as "top quality").
- Why are we just talking about Wikipedia? What about Wikisource, Wiktionary, etc. doesn't suggest any way in which to choose Wikisource or Wiktionary content. I love the idea of having a variety of content types up there and this would be great PR for those projects, but I simply don't know how to picture it.
Anyone have any ideas for how to improve these scenarios? ~Mable (chat) 07:22, 9 May 2016 (UTC)
Scrapped scenarios (see "Dealing with ineffective scenarios" above for details)
[edit]Scenario: Use an SD card
[edit]|
basic idea: SD cards hold many GB of data and are smaller, lighter and more robust than discs. With proper compression all current versions would fit. tbd. Discuss |
Discussion scenario #SDCard:
[edit]I love this idea, if all versions of wikipedia fit, why not?Miguu (talk) 15:18, 21 April 2016 (UTC) Support, but to a storage medium which can survive harsh climate: Only A non-destructable storage medium should be used. Actually a ""lightweight solar powered reader"" also should be included if possible. AKNEAL (talk) 16:30, 22 April 2016 (UTC)
Sorry, but this semiconductor device wouldn't manage with effects of radiation from the Sun. DryominG (talk) 16:27, 21 April 2016 (UTC)
- I concur, only a person without insight into physics would even suggest SD for long term storage and even less so for space. Laser etching into stable surfaces and 3D-storage using varying laser focus lenses are better approaches. Anyone approaching 10 years for data on an SD memory on earth should rewrite it or data is likely to be lost. Bytesock (talk) 17:56, 21 April 2016 (UTC)
However, if now one is going to read it, what does it matter if the radiation affects the SD? we can encapsulate the SD in some protective plastic cover... Golan's mom --אמא של גולן (talk) 15:48, 21 April 2016 (UTC)
You can check what was happened with CubeSat memory. After a while you'll get a mess of bits and damaged cells of memory... Of course plastic case wouldn't help. DryominG (talk) 16:27, 21 April 2016 (UTC)
Support if feasible No one has said what kind of shielding the vehicle will provide. Assuming that shielding is available for a semi-conductor tech then it would be the logical go to. This trumps all other suggestions as it includes the entire project. Although there IS a lot of superfluous nonsense and stuff like bio articles, every kids garage band, etc, that have squeezed their way into pseudo notability that could be dropped it would be better to do an 'all or nothing' approach. There are other technologies superior to any 'disc' that can't fit a flipping copy of Wikipedia on it though. BaSH PR0MPT (talk) 16:01, 21 April 2016 (UTC)
- '"Support if feasible"' per BaSH PR0MPT (nice uname btw) Blackhat999 (talk) 16:51, 21 April 2016 (UTC)
None of our electronic media are likely to survive for more than a few decades, so this is a gesture rather than a true off planet archive. On that basis yes by all means send an SD card with everything. Striking that - yes a one thousand year archive would be long enough to be interesting. WereSpielChequers (talk) 16:26, 21 April 2016 (UTC)
- While you're right this basically a symbolic gesture, the questions remains what sort of symbolism do you go for? Do you want to send something that we all know will probably have very little recoverable data before the next year after it leaves earth, or do you want to have something that can potentially at least last decades presuming nothing unexpected happens? I don't know what exactly the ceramic disc they're planning to use is. (I guess it's probably something fancier than an w:M-DISC) but I suspect they're aiming for it to theoretically be able to at least last several decades. (Although it's difficult to really predict given the difficult truly simulation the conditions so the estimates are likely to be very rough.) In any case, if I'm understanding the about page correctly, this isn't going to be the only ceramic data disc they send. In other words, the chance they'll be interested in adding some other random item like an SD card rather than a disc they've already decided on planned to include is probably slim to none. Nil Einne (talk) 17:11, 21 April 2016 (UTC)
- From discussions on the talk page, seems it is actually an M-DISC. While 100 GB ones exist now, they are fairly new so the team don't trust them enough and at the moment are planning to stick with the 100GB ones. Nil Einne (talk) 17:52, 23 April 2016 (UTC)
Support I believe this option is entirely feasible to accomplish. Rather than replacing the ceramic disc, we could add a couple SD cards to go with it. With their max capacity at 128 GB, we can include most of the text articles for the large Wiki projects. I'd be happy to donate a few of them to this project. As far as shielding, don't they have to shield most of the internal electronics anyway? I think we need an opinion from someone who knows more about that part. If we can send the SD cards with the ceramic disc, we can include a lot more data than originally planned. And if they don't last as long, so what? We won't know until we try. AfroThundr3007730 (talk) 17:50, 21 April 2016 (UTC)
- Support if feasible if it's not going to be damaged by sun Super ninja2 (talk) 20:11, 21 April 2016 (UTC)
Oppose Cosmic rays and the Van Allen belts will toast the flash memory in short order. Here on the ground, SD cards are protected from cosmic rays by 100 km of atmosphere on one side and the bulk of the planet on the other, and Van Allen radiation isn't a concern at all. It takes a lot of shielding (meaning: weight. meaning:exponentially increasing fuel costs) to make up for that. Data compression makes the problem all the worse: The better it's compressed, the more damage is done by a single corrupted bit, and the less recoverable the data becomes. 20:04, 21 April 2016 (UTC)
Support if possible We need a backup of the current version of Wikipedia (or as many articles as possible) that people can't mess around with. If the number of editors keeps getting smaller, the number of people fighting bad edits and trolling will also drop, and the quality of this encyclopedia might suffer because of it. Right now, Wikipedia might be at its peak. Project team member Karsten Becker says something like this in the FAQ: "If you’ll take a look at Wikipedia in 10, 50 or 100 years, it will look totally different. We think it’s a good idea to store a decentralized back-up that no one can change so easily". Mwvandersteen (talk) 20:56, 21 April 2016 (UTC)
Suggestion / question I don't know much about lunar vehicles, or metal, so bear with me on this one, but if weight is an issue, perhaps the data could be carved into the metal of the lunar rover itself? Or could the data carrier be welded into one of the sides or bottom of the rover, to become part of the vehicle itself? Mwvandersteen (talk) 20:37, 21 April 2016 (UTC)
Suggestion / question I guess "Eternal 5D" data storage won't be available on time? It would be really cool to use it! Mithoron (talk) 21:53, 21 April 2016 (UTC)
Support or Find Better Data Storage Since the goal is to be on the moon by 2037, why limit this to currently available technologies like SD? There's no reason to believe that by 2037 we won't have something like the en:Holographic Versatile Disc, which is supposed to store 6TB, or better by then! I have no idea why it wouldn't be trivial to get a large amount of data with a small form factor that will stand up to whatever it needs to survive the radiation in space. Zzyzx (talk) 23:38, 21 April 2016 (UTC)
Comment The actual deadline for the Google Lunar XPRIZE Challenge is December 2017, not 2037 (I have corrected this on the main page). Therefore, further discussion on possible data storage mediums should be focused on technology available about now. Yiosie2356 (talk) 01:44, 22 April 2016 (UTC)
- For those confused by the above since they only ever saw 2017 before this subdiscussion even started, it was unfortunate vandalism I think [10] [11] Nil Einne (talk) 17:23, 23 April 2016 (UTC)
GET A CLUE KIDS!, any flash memory like SD, CompactFlash, EEPROM, USB-memory, SSD etc will all be toast in space due to the high radiation environment. It's nothing at all like how things behave on the Earth. Adding to the misery is a long term stay to ensure some nasty rays comes around. Any serious effort has to use a laser heating fused silica glass or inert metals or similar methods. Even a BluRay M-DISC stands a better chance than any SD memory. Bytesock (talk) 03:53, 22 April 2016 (UTC)
Oppose, flash memory is too fragile and would be more difficult to read correctly by entities of the future. The disc needs to be something that can be readable in the long term; even shielding may not help since the moon's surface has a lot of charged particles. Also, I think a simple binary code etched on a surface (like with parts of the Voyager disc) would be much easier to process later. Rememberlands (talk) 05:59, 22 April 2016 (UTC)
ROM: What about using a real ROM? They used to be quite common before rewritable flash memory became popular. A ROM chip with hard-wired information should resist all kind of radiation and a snapshot would be read-only anyway. [[User::Waterpath|Waterpath]]
Idea: ALL WP languages! No 20 GB Why do you stayed edge of 20 GB? 1 Blue Ray disc can include 70-80 GB. 1 HDD can include 6-7-8-more TB! Maybe, HDD is too big and heavy to the space machine? Use TransFlash! One MicroSD card can include 200 GB data; if you use some MicroSDs with weight equal to 1 Blue Ray Disc, they could include over terabyte of Wikipedias, it can include ALL linguistic parts of WP! (Sorry for my English, i'm Russian, if you can, please speak Russian, thx!) Фред-Продавец звёзд (talk) 09:36, 22 April 2016 (UTC)
Oppose using any type of flash memory, not reliable and can easily be damaged by cosmic radiation, gamma ray bursts, deadly CMEs and possibly other cosmic disturbances. Davidbuddy9 (talk) 23:18, 22 April 2016 (UTC)
Support There is already an example of flash memory operating in high radiation environments see CubeSat and Pluggable Processor Module this solution can be implemented for this project.Quantanew (talk) 01:24, 23 April 2016 (UTC)
Support Send all of Wikipedia on flash storage, properly shielded. Also send an etched disc with a limited selection of Wikipedia, as per one of the other scenarios. On the disc, include information designed to teach the aliens the languages of Earth. Maybe also include instructions on how to decompress the data on the flash storage.
Suggestion doesn't even really make sense – The team of astronomers happens to have 20 gigabytes of disc space left which will go with the rover either way. They want to use it for something and thought Wikipedia articles was a neat idea. Are you guys seriously telling the team that they should take something extra with them? If you guys can pool up some money together for an extra storage device and the fuel needed to get it on the moon, that's fine by me. Even so, this still doesn't solve the question of what should be placed on the disc, which will go up there either way. ~Mable (chat) 08:14, 23 April 2016 (UTC)
Idea IIRC the reason SD cards fail over time is because the cells retain their state using capacitors, and after a period of time those capacitors lose their charge and the cell state can no-longer be relied upon. So to retain their state we need to keep the capacitors charged. Seems likely to me we could do this with a solar panel. (Assuming it is possible to solve the radiation problem) Mattcopp (talk) 08:30, 29 April 2016 (UTC)
Scenario: Don't decide
[edit]|
basic idea: User:Millosh pointed out this fascinating article [12][13] about a super compact storage in glass with exceptional thermal stability and durability. We should focus our efforts on recruiting the manufacturer and raising needed funds, rather than dithering over what content to keep. It's just a tremendous waste of time to try to pick out a sliver when we should be helping to advance technology -- to the Moon! Discuss |
Discussion scenario #Don't_decide:
[edit]The "edit section" links don't work and the button to add an idea don't work for me, so I'm just winging it. And I have no idea how translate works ... I doubt my section will translate. Anyway, if you happen to land here, good luck! Wnt (talk) 16:26, 24 April 2016 (UTC)
- Yeah, I have no idea what's going on with the section editing. Anyway, about the idea of raising funds for a better storage device... you can try, I suppose, but I don't know with how much enthusiasm that idea will be met. I'd rather spend community effort on improving Wikimedia projects to make them "ready for take off" than to spend community effort on collecting money for a side-initiative. Besides that, the kind of money needed for this kind of thing may be unexpectedly high. It might be worth getting someone to calculate it before we vote on this idea at all. The scientist team might still use the disc they're already planning to take, though. ~Mable (chat) 19:14, 24 April 2016 (UTC)
- I wasn't thinking of redirecting donor money from Wikipedia per se. Rather, Wikipedia would have a special fundraising appeal just for this. The company making the discs should certainly be expected to offer a discount / matching funds, since the appeal is free advertising for them and the stunt itself more so. Wnt (talk) 01:15, 25 April 2016 (UTC)
- Every few months, someone announces a wondrous new storage technology. Maybe once a decade it actually works as advertised. --Carnildo (talk) 00:11, 26 April 2016 (UTC)
Scenario: One step back first, take care about the aim
[edit]|
basic idea: What is the aim of the moon-programm? I would say sending information to space, that explains earth/us; using Wikipedia. So before selecing articles etc. there sould be explained what an encyclopedia and Wikimedia/Wikipedia is, like explaining something to a child of which you don't know the language. After the explanation everything can be illustrated with the best articles/images in different languages etc. Discuss |
Discussion scenario #Aim:
[edit]Why the Moon? Who will recover this?
[edit]Earth’s landscape is subject to massive amounts of change. Weather, erosion, glaciation, volcanism, even subduction via plate tectonics. Anything left on Earth will be buried, sent to the bottom of the sea, or even recycled into the mantle by forces ranging from the actions of earthworms and the growth of plants to the flow of streams, rivers, glaciers, wind, and lava. Earth’s surface is dynamic, continually broken down and renewed. Even if it were indestructible enough to survive these situations, any object on Earth is going to be simply lost after sufficient time. --Aranae (talk) 20:18, 12 May 2016 (UTC)
An object on the Moon, associated with an obvious artifact like a rover, is going to be easily recovered and will be a source of curiosity. It will be subjected to solar radiation and an elevated chance of meteorite damage, but is otherwise likely to sit there for billions of years. Longer than Earth’s continents exist. --Aranae (talk) 20:18, 12 May 2016 (UTC)
The Moon is our natural museum, a place for curated artifacts to persist for incomprehensible spans of time. It is also right next door. Earth may serve as a source for waves of intelligent civilizations, perhaps many waves of many species across hundreds of millions of years. It is also a great big beacon for extraterrestrials; the presence of life clearly on display at a distance thanks to factors such as the oxygen atmosphere. The Moon is a massively superior location for a “Golden Record” than a small probe sent haphazardly into deep space. --Aranae (talk) 20:18, 12 May 2016 (UTC)
Who might encounter this artifact?
1) Near future humans who might treat it much like a time capsule
2) Future human civilizations very different from our own, perhaps after some sort of Dark Ages
3) Future species evolved from humans
4) Future intelligent species evolved from other animal species
5) Extraterrestrials arriving prior to human extinction
6) Extraterrestrials arriving after humans have gone extinct
Much of the discussion on this talk page has focused on #1. Yes, if this is all that this project accomplishes, it is a bit of an expensive publicity stunt. But everything else on this list represents a huge opportunity. Some even represent a chance to bring humans back from extinction or restore humanity as we know it. This could easily be the most important thing that any of us have ever been involved in. If not directly with this proposed launch, then at least by highlighting how this sort of thing should happen in hopes that a bigger project of this sort might be considered in the future. --Aranae (talk) 20:18, 12 May 2016 (UTC)
- @Aranae: I appreciate your enthusiasm. We should keep in mind that near-future human colonizers are the most likely reader of this disc, as the stored information might not last more than a few hundred years before it starts to deteriorate (though the exact data is pretty vague). I definitely don't think we should assume that an alien species will find this disc, and I think we should treat the content of the disc as "education content" first and foremost. We should also keep in mind that the team approached Wikimedia for the kind of content that Wikimedia deals with. The sequence of human DNA is not the kind of thing we as a project deal with, so it wouldn't make sense to add such information to the disc. Meanwhile, culture (art), history, science, people, those are topics that we cover, and that is the kind of content we should probably have on there. Such content would still be insanely useful for future archaeologists.
- The important aspects of how ground-breaking technologies (such as nuclear power as we know it) work would also be detailed in this file (though anyone able to access the digital information might already have such technology). The encyclopedic article on humans describes what humans are in a manner that may be much more important than a sequence of DNA.
- This all can be discussed quite a bit, but honestly, I'd rather see you think up a scenario that you think would be best. Of course, it could still be discussed and edited before the actually voting process. "What we want remembered" might simply be all top-importance articles or all "vital" articles, but if you want to combine one of those ideas with something else (like Wikidata), go ahead and describe your idea! ~Mable (chat) 09:51, 13 May 2016 (UTC)
Priorities: 1) Human de-extinction, 2) Facilitate translation 3) Aid interstellar colonization 4) What we want remembered 5) What our readers will want to know
[edit]Priority #1 Human de-extinction
[edit]Extinction does not need to be forever. At present various researchers have proposed bringing back a wide variety of extinct species. We are just at the threshold of being able to do so and there’s no reason to believe that a more advanced civilization couldn’t do it even better. But, Jurassic Park notwithstanding, we cannot bring back species that have been extinct for millions of years. We would need DNA to do so and that information for those species is lost to time. Under optimal conditions, DNA can be preserved on Earth for a couple hundred thousand years. Even if we assume that future advances push that back tenfold or more, we’re still looking at a limited shelf-life to sending DNA itself. --Aranae (talk) 20:18, 12 May 2016 (UTC)
But DNA is fundamentally data. The absolute minimum information required to bring back an extinct species is going to be a copy of its genome. If humans were to go extinct, there is currently no off-world blueprint available to bring us back. It’s unfathomable that we haven’t backed up a copy of what may be the most important piece of data in the universe. I propose to include a copy of the human genome. If recorded in bytes, this would require ~3GB. There are only 4 states (ATCG) to DNA, however, so the data can be recoded into a format that would require <1GB. Prioritize wikipedia articles that will help make sense of the copy of the human genome and that might assist with the de-extinction process. Things like methylation patterns, proteomic data, and basic infant care will help to make a human. Technologies involved with de-extinction would be valuable as well since we don’t know what order alternate civilizations might acquire their tech. --Aranae (talk) 20:18, 12 May 2016 (UTC)
Priority #2 Facilitate translation
[edit]“Planet Earth already uses a language. It’s comprised of four letters, A, T, C, and G. With proteins, you have 22 amino acids, the ‘words’, and there are even ways to express the start of a sentence or the period at the end.” (“Not Quite Taterona kempi”, p 30)
In the May 2016 issue of ‘’Analog Science Fiction and Fact’’ I just published a story (“Not Quite Taterona kempi), focused on this exact topic. In the story, plans are in place for a giant repository on the Moon. The protagonist of the story, a biologist, ends up assembling an argument for why this repository would be largely unreadable unless much of the content is includes metadata that labels living organisms using DNA markers. The other half of the story shows the actions of a future intelligent species actually translating the information thanks to these tags. I’m not only spoiling that story here, but I’m also giving away someof my plans for the sequels here. So be it, this could really be worth it. -Ryan W. Norris, AKA --Aranae (talk) 20:18, 12 May 2016 (UTC)
Undeniably a seriously challenging aspect of this proposal will be the need to actually be able to read the data on the disc. It’s too bad there is not at least some sort of micro-etchings or something that can at least transmit some information and perhaps give an aid in reading the rest of it. Regardless, that appears to be what we have to work with so I will not go into that further. It is still worth noting that the disc will need to be read, 1s and 0s, will need to be recognized as bytes, those bytes need to be translated into letters, etc. DNA data can help with even that as I will explain later. --Aranae (talk) 20:18, 12 May 2016 (UTC)
If the proposed data disc is discovered and read while something closely resembling contemporary human civilization exists, then the use of multiple languages will probably serve as the needed Rosetta Stone. Some variant of a descendent of some language will probably exist at least in a scholarly sense. But that scenario is not the real value in this data disc. If adequately shielded from cosmic radiation, this disc may last for billions of years. Longer than the pyramids, longer than mountains, longer than continents. The true value here is the possibility that some truly alien intelligence (extraterrestrial or terrestrial) encounters this. An English translation of a German article will not help anyone in that scenario. --Aranae (talk) 20:18, 12 May 2016 (UTC)
If you’ve been to the Moon, you can go to Earth. Earth is the interesting place; it’s where any sensible alien intelligence is going to devote serious effort investigating. And there are somewhere between a million and a trillion species on Earth who all encode data using the same nucleic acid language. If you have access to Earth’s biosphere, you have access to a simply encoded form of storing data that encodes for immensely complex things. --Aranae (talk) 20:18, 12 May 2016 (UTC)
“If you gave me a DNA sequence of sufficient length, I could match the organism it came from. Even if no one had ever seen that species before, I could still figure out what it’s related to and even how distantly they’re related.” (NQTk p 30)
Genes that code for proteins start with the same sequence: ATG (AUG in RNA). A long string of characters that involves only 4 possible states and consistently start with the same 3 letters is going to be obvious for any advanced intelligence who has studied Earth’s biology, probably even those who are unaccustomed to recording information in a manner that remotely resembles how we do so. In fact, I would argue that it is so obvious that it’s a sure bet that someone in their society will go looking for that type of data. The actual letters aren’t going to mean anything, but the use of 4 possible states, especially when the same 3 characters start each sequence will clue you in quickly. It will even go a long way in establishing how many bits are present in a byte. --Aranae (talk) 20:18, 12 May 2016 (UTC)
A 25 bp piece of DNA, ATGACCCCGACACGCAAAATTAACC, means “great ape cytochrome b gene” in any language. A slightly longer 50 bp piece, ATGACCCCGACACGCAAAATTAACCCACTAATAAAATTAATTAATCACTC, in unambiguously “chimpanzee cytochrome b gene”. But what if chimpanzees (and bonobos) are extinct? Well, ~100 bp fragment: ATGACCCCGACACGCAAAATTAACCCACTAATAAAATTAATTAATCACTCATTTATCGACCTCCCCACCCCATCCAACATTTCCGCATGATGGAACTTCG is enough to demonstrate that the animal in question is a great ape that is part of the human-gorilla clade, is more closely related to humans than any other species, and will even provide information indicating how long ago humans and this mystery species last shared a common ancestor. The longer the fragment, the more precisely this information can be resolved. What about a mass extinction that’s wiped out any close relatives? Well, a sufficiently long chunk of Tyrannosaurus DNA would indicate the animal in question is more closely related to birds than any other living animals. Velociraptor DNA would be even more closely related to birds than Tyrannosaurus, whereas Triceratops would be more distant. The fossil record would be a great help in resolving these things. Regardless, this is massively more useful than a random string of characters, which is what “Tyrannosaurus” would be to any alien intelligence. The principle here is the same as DNA barcoding. --Aranae (talk) 20:18, 12 May 2016 (UTC)
“So you have a lot of nouns... That’s nice, but there’s more to language than nouns. And more nouns than this approach can express for that matter.” (NQTk p 30)
By knowing the identity of living species, our nonhuman translator now has a critical starting point. S/he can start to look for patterns elsewhere in the document. References to flight will be found in articles on birds, bats, and insects. Nighttime in articles about nocturnal species. Color can evolve rapidly in some species, but in other groups have been consistent over millions of years. Once these non-biological concepts can be determined, the rest of the information can start to fall in line. --Aranae (talk) 20:18, 12 May 2016 (UTC)
“It’s anyone’s guess whether or not an alien philosopher can comprehend the forbidden love in the bedchamber scene of Romeo and Juliet, but there’s no doubt that an alien biologist with access to Earth could figure out the difference between a lark and a nightingale singing.” (NQTk p 30)
Because of the density of information, the existing 4 character alphabet, and their ability to uniquely code for an organism, nucleic acids are probably the strongest starting point. Yet I also recommend that articles pertaining to concepts in physics, chemistry, math, geology, etc. be given priority. An alien intelligence probably doesn’t need us to explain the periodic table, but the periodic table is another place where patterns can be found and applied to understand the disc as a whole. --Aranae (talk) 20:18, 12 May 2016 (UTC)
Priority #3 Get us off this rock
[edit]Popular science fiction has always lied to us in order to tell a good story. Faster than Light Travel is probably going to always be impossible. Transporting living organisms to another solar system is almost certainly going to be very hard. Terraforming a planet to have a biosphere that supports our kind of life is going to be extremely challenging. Humans could not have survived even on planet Earth for most of its history. For example, photosynthesis evolved ~2.3 billion years ago, but it took another 1.5 billion years for oxygen to start to accumulate in the atmosphere (because rocks and the ocean were absorbing it), and it wasn’t the Carboniferous, 350 million years ago, that levels were high enough for the levels that we humans require. That’s 2 billion years just to get one (very important) component of a breathable atmosphere. In all likelihood, a successful terraforming operation will take tens or even hundreds of millions of years to accomplish even with unthinkably advanced tech. This goes beyond merely being about generations of humans, it requires generations of human civilizations, and potentially generations of intelligent terrestrial species. --Aranae (talk) 20:18, 12 May 2016 (UTC)
We all know that the Sun will become a red giant and either engulf the Earth or very nearly do so within another 5 billion years. Much sooner than that, however, we can expect the Earth’s oceans to evaporate, plate tectonics to shut down, and the planet to become inhospitable. Estimates range from 100 million to a billion. The clock is ticking. --Aranae (talk) 20:18, 12 May 2016 (UTC)
As we’ve seen on Earth, different cultures develop different technologies at different rates. This pattern will be much more extreme when we start talking about different species. I propose that Priority #3 be granting the future any information that could potentially facilitate traveling to and colonizing a planet orbiting another star. --Aranae (talk) 20:18, 12 May 2016 (UTC)
Priority #4 Preserve what makes us human
[edit]There’s a debate in the de-extinction community whether a woolly mammoth brought back would still be a woolly mammoth since it is far removed from the long history of behaviors passed down from its ancestors. This would be even more true of humans. Priority #4 should be trying to preserve what makes us human. Maybe that’s Shakespeare or Mozart. Maybe it’s religion or philosophy. Perhaps it’s as basic as an explanation of how to swaddle a baby. Basically, Priority #4 is to preserve what we want them to know about us. The fact that Project Gutenberg is involved is a great start. --Aranae (talk) 20:18, 12 May 2016 (UTC)
Priority #5 What do they want to know?
[edit]Finally, imagine Earth had an intelligent species living here before us. What would you wish they had told you? Cold fusion? An explanation of Mesozoic ecology? A better sewage system? A description of what Deinocheirus really looked like? --Aranae (talk) 20:18, 12 May 2016 (UTC)
Technical options for data retention
[edit]Discussion scenario #SDCard:
[edit]I think multiple users have already indicated what the idea of using SD card (or any sort of flash memory) for long-term storage, especially in space, is the patent nonsense. I agree with it. Even the best flash variety, the SONOS flash cell may withstand a higher dose of radiation damage, but it will still discharge and flip inevitably within decades.
Discussion scenario #Don't_decide:
[edit]Use the 1.8 inch HDD. Or just the disks of HDD, without enclosure and readout electronics if maximal weight is constricted. It gives up to 500 GB of data storage. The HDD magnetic domains are truly bistable, so minor radiation damage is automatically repaired. The limiting factor will be rather crystal damage and gradual reduction of coercive strength (degraded magnetic domain do not change polarity like flash cells though, so can be still read by sensitive enough probe) Also, the readout of mechanically damaged disk is much simpler compared to flash (do not need a functioning on-chip semiconductor devices for readout or addressing)--Trurle (talk) 05:32, 21 May 2016 (UTC)
Social sites
[edit]Hi all,
Try this Facebook page about the project. You are welcome with the collaboration. ~ Moheen (talk) 09:59, 23 May 2016 (UTC)
- And this is twitter account for @WikipediaToMoon. You are welcome with the collaboration. ~ Moheen (talk) 21:23, 11 September 2016 (UTC)
Time capsule article
[edit]I found this article on Atlas Obscura that looked interesting and relevant to this project. We might even want to collaborate with the International Time Capsule Society to see what they have to say. If we can get a Wikipedia 1.0 that's 25 GB and fits on a single-layer Blu-ray disc, that would be ideal. http://www.atlasobscura.com/articles/the-inevitable-intergalactic-awkwardness-of-time-capsules Tonystewart14 (talk) 05:10, 27 May 2016 (UTC)
Preparing Phase 2: voting
[edit]Hi everyone, I know there's a section on voting above, and I will leave a message there. But I'm adding this section to share thoughts about the upcoming voting, and gather feedback about how to do it. Here's the stuff we've been thinking about:
- Scenarios: Some people here on Meta have removed scenarios like the SD card. There are a couple of scenarios left that go beyond the scope of Wikipedia, e. g. the Wikidata suggestion or the sister projects. We've been contacted about Wikipedia and on purpose, so I'd advise to only vote on Wikipedia scenarios. All other scenarios could be listed on the voting page, here on Meta.
- Eligibility: Anyone may vote, regardless of user access level or rights. Logged-in voting is probably necessary, because I'm afraid that we can't handle a mass of IP votes.
- voting method: affirmative, meaning that any vote is cast in support of a scenario; no "oppose" or "neutral" votes. This is meant to reduce complexity.
- number of votes: as many votes per person as there are scenarios. Not more. You may vote for all scenarios, or just a few, or just one.
- Who wins: The scenario with the most votes (remember, affirmative votes only) wins. No absolute majority, no percentage threshold. Just number of votes.
...However, we think there should be an option for those who have voiced criticism. So, I'd say it would be fair to add a voting option "no global working phase". People who don't like the idea of taking Wikipedia to the Moon could choose this option. With this voting option added, we would have 1 way to say "I don't want this" and (about) 10 ways to say "I want it". Well, technically you could of course vote "for" and "against" at the same time, ...but that wouldn't make sense, really. In short: Since supportive votes may be split to 1/10th in comparison to every opposing vote, we'd suggest the threshold for the "no global working phase" in order to win should be more votes than the pro-votes, i. e. all other scenarios combined. To sum up: The goal here is to keep it as simple as possible. Anyone may vote, and for any option, including saying "no". What are your thoughts? This is a suggestion, but I don't want to impose anything, so I'm posting the framework here for feedback. --Michael Jahn WMDE (talk) 12:54, 27 May 2016 (UTC)
- Two notes 1] Be confident! Either you allow IPs to vote or you don't. I would keep it with auto-confirmed accounts, though, for the reason given. 2] I highly suggest clearly indicating or removing any options that simply aren't allowed. If Wikidata is beyond the scope of this project (though I don't see why that is), make that clear by not even allowing people to vote on it.
- Whether your affirmative voting process is the most effective, I have no idea. Regardless, if I understand correctly, we may end up in a situation where a voter would be forced to pick an option they don't particularly like because that would be the only way to beat "no". Are all "yes" votes counted together when contrasting with the "no" votes? Does it even make sense to allow people to vote against this project? ~Mable (chat) 14:01, 28 May 2016 (UTC)
- Thanks for your advice, @Maplestrip:! Keeping it with auto-confirmed accounts sounds sensible. As to 2], yes, let's do that! And as to counting votes, yes, all "yes" votes would be counted together when contrasting with "no". Seeing the criticism voiced on this page, it seemed awkward to ignore it. It's an open suggestion to the communities. I guess you're right about the dilemma of having to pick a "yes" option, even if you don't particularly like any of the scenarios, as long as you want to "beat 'no'". But then again, if we added a way to vote supportive without saying how to proceed, we might end up with support but no clear scenario – or, in other words back to the start. I would say, though, that you can cast your "yes" vote for quite a number of scenarios, or even all of them (if you don't want to favor one over others). --Michael Jahn WMDE (talk) 11:02, 30 May 2016 (UTC)
- Alright, sounds good :) ~Mable (chat) 11:22, 30 May 2016 (UTC)
- I agree that this is a good plan for voting. I wonder if consensus might build around bits and pieces of different proposals. Perhaps there should be a discussion at a later stage involving those proposals with broad support. I like #Moon, for example, but there will be lots of leftover disk space. I struggled with creating the #DNA proposal since I knew I was blending aspects that might be controversial with those that are likely to gain broad support. I've also considered creating another proposal called Extinction, which focuses on prioritizing species, habitats, culture, languages, world heritage sites, etc. that risk going extinct in the next century or so, but I've not done so because I think #DNA is a more important proposal. --Aranae (talk) 16:05, 30 May 2016 (UTC)
- I'd definitely be alright with items that gained somewhat broad support and are considered small in scope (like "Moon") to be discussed simultaneously with the more popular pick, if there is more disc space left. I expect even ideas with a larger scope (like "all top-importance articles") to not make full use of the disc place, so there should be plenty of space left. This would have to be managed well, though, I think. ~Mable (chat) 20:54, 30 May 2016 (UTC)
- There's one scenario suggesting basically just that. I think it's valid, and it would be interesting to see the implications, @Aranae:. If this one was chosen, it might come in handy that the working phase is so long, starting in July, because I guess that with this scenario there would need to be substantial coordination necessary. Really interesting, indeed! --Michael Jahn WMDE (talk) 14:13, 31 May 2016 (UTC)
- I'd definitely be alright with items that gained somewhat broad support and are considered small in scope (like "Moon") to be discussed simultaneously with the more popular pick, if there is more disc space left. I expect even ideas with a larger scope (like "all top-importance articles") to not make full use of the disc place, so there should be plenty of space left. This would have to be managed well, though, I think. ~Mable (chat) 20:54, 30 May 2016 (UTC)
- I agree that this is a good plan for voting. I wonder if consensus might build around bits and pieces of different proposals. Perhaps there should be a discussion at a later stage involving those proposals with broad support. I like #Moon, for example, but there will be lots of leftover disk space. I struggled with creating the #DNA proposal since I knew I was blending aspects that might be controversial with those that are likely to gain broad support. I've also considered creating another proposal called Extinction, which focuses on prioritizing species, habitats, culture, languages, world heritage sites, etc. that risk going extinct in the next century or so, but I've not done so because I think #DNA is a more important proposal. --Aranae (talk) 16:05, 30 May 2016 (UTC)
- Alright, sounds good :) ~Mable (chat) 11:22, 30 May 2016 (UTC)
- Thanks for your advice, @Maplestrip:! Keeping it with auto-confirmed accounts sounds sensible. As to 2], yes, let's do that! And as to counting votes, yes, all "yes" votes would be counted together when contrasting with "no". Seeing the criticism voiced on this page, it seemed awkward to ignore it. It's an open suggestion to the communities. I guess you're right about the dilemma of having to pick a "yes" option, even if you don't particularly like any of the scenarios, as long as you want to "beat 'no'". But then again, if we added a way to vote supportive without saying how to proceed, we might end up with support but no clear scenario – or, in other words back to the start. I would say, though, that you can cast your "yes" vote for quite a number of scenarios, or even all of them (if you don't want to favor one over others). --Michael Jahn WMDE (talk) 11:02, 30 May 2016 (UTC)
- I see no reason why proposals like #Wikidata would need to be excluded from voting (#Not, however, is accounted for by the proposal to have a yes/no question). There's a gray area between a proposal that's fully in line with the request, one that's still in compliance but stretches the definition, and one that's outside the scope entirely. A good bit of curating was recently done on the list, which already dealt with much of this problem. Voters will have the opportunity to take this information into account when voting. If the powers that be reject our chosen proposal, then there is always going to be a second place, third place, etc. finisher. This page is full of criticism of the project (fair or otherwise) and letting people support alternates that are a bit afield from the initial scope may actually be the best way to reach a consensus. --Aranae (talk) 16:05, 30 May 2016 (UTC)
- I too am sad that Wikidata is going to be left out. It's not one that I would have picked, but it definitely had some interesting positives to it. I wouldn;t say that my curating dealt with most of this problem, though! I got some of the more annoying ones out, but I am hoping for some better curating and perhaps some rewording from the project leaders. ~Mable (chat) 20:54, 30 May 2016 (UTC)
Update: end of Phase 1
[edit]Hi everyone, I've just edited the site header. Phase 1 is now labeled "done" instead of "ongoing" (<--diff), because June 3 was set as deadline for collecting scenarios. Problem is, the header template on Home, FAQ and About remain unchanged. There the header still says "ongoing". Site visitors won't see the changed status in the header :( Purging cache doesn't work. I don't know what's wrong. Maybe because of translation tags? Anybody have a clue? Like, @Martin Rulsch (WMDE):?
Anyway, what I actually had planned to explain here about switching phase 1 from "ongoing" to "done": Voting (see above) will begin in one week, on Friday 10. That's because we need to go through the scenarios and prepare the page. Please note that calling phase 1 "done" only refers to adding scenarios. Anyone may, of course, continue to discuss scenarios. There's no page protection or anything. Also, I am aware that a deadline like "June 3" is rather unspecific, because it doesn't say when on June 3, and even if we'd interpret it as 23:59 on Friday night – which time zone??? In short: If you feel like like adding another scenario, and it's still Friday, June 3, in the place where you are editing, feel free to post it! --Michael Jahn WMDE (talk) 17:11, 3 June 2016 (UTC)
- It indeed was the cache, everything seems to be correct now. Cheers, Martin Rulsch (WMDE) (talk) 08:32, 6 June 2016 (UTC)
Phase 2: voting has begun
[edit]Hi everyone, we’ve just edited the voting page, and it is now open for you to cast your votes. There are messages going out via mailing lists and village pumps, inviting people to join the decision-making. Thanks again for your feedback about the design of the voting process! --Jan Apel (WMDE) (talk) 15:13, 10 June 2016 (UTC)
- I noticed my "Top Importance" scenario isn't present on the voting page. Is there any reason for this, or was this an error? ~Mable (chat) 07:22, 13 June 2016 (UTC)
- I can't imagine how there could have been an objective to it on technical grounds. It must have been an oversight. I propose that it be added to the list as soon as possible to minimize the disadvantage that comes to from being late. --Aranae (talk) 13:32, 13 June 2016 (UTC)
What kind of disk, and what durability on the moon?
[edit]I see little point in starting the voting for different "what contents to put on the disk" scenarios when the key question that I asked here is still unanswered. The moon has no magnetic field and no atmosphere and so any object on its surface is in full blast of the solar wind. How long will a standard CD-ROM, DVD, or blue-ray disk last there -- or are we talking of a special kind of data disk which is designed to last hundreds, thousands or millions of years in space? The whole "Wikipedia to the Moon" idea is mainly a symbolic act, which is fine as such, but the symbolism is bad when we do it although we know the data disk we send with much tamtam to the moon it is going to be destroyed by solar wind within days, months, or a few years. It would make us all look like idiots, as if we hadn't looked at the perhaps most important question. --Neitram (talk) 13:32, 13 June 2016 (UTC)
- I believe it has been explained pretty adequately, though I don't remember the technical details. My understanding is that the disc that will be sent up should last a few hundred years. ~Mable (chat) 13:54, 13 June 2016 (UTC)
- See this post. Tonystewart14 (talk) 21:37, 14 June 2016 (UTC)
- What about playback? JerrySa1 (talk) 13:09, 29 August 2016 (UTC)
- See this post. Tonystewart14 (talk) 21:37, 14 June 2016 (UTC)
Compression
[edit]We can assume that the aliens in outer space, and also the earth people in millions years, are going to hell of a lot smarter than us. So use this as a compression algo:
Write every ((size of Wikipedia in bytes) / 20000000000) byte to disk.
--Bep (talk) 17:58, 18 June 2016 (UTC)
Disk space
[edit]How to find disk space of featured articles and lists for one language? --Evolutionoftheuniverse (talk) 06:15, 4 July 2016 (UTC)
- We actually have the space for all of them.... ten times over. JerrySa1 (talk) 00:54, 15 July 2016 (UTC)
FA
[edit]hi I left this on the other talk page[14], basically since its so much in WP:en (Feature article list), should there be a specific thing to do (a process) to make it more manageable?(please answer here or at link, thanks)--Ozzie10aaaa (talk) 15:36, 9 July 2016 (UTC)
- (answered at other link)--Ozzie10aaaa (talk) 15:03, 25 July 2016 (UTC)
Working deadline
[edit]@Denis Schroeder (WMDE): and others, what is the working deadline? Was it 31 October or it is still possible to write (or organize local votings for) articles on Wikipedias so that they get included on the disc? --Obsuser (talk) 16:59, 11 November 2016 (UTC)
- @Denis Schroeder (WMDE):, @Martin Rulsch (WMDE):, could you update the status of the project? AFAIK, no deadlines are firm here because this thing will simply not fly to the Moon, at least not in the framework as proposed - but I am happy to be proven wrong. Nevertheless, it is 16th of November and the organization does not have a launcher booked (and it has only 45 days to do it), and it is only a year to deliver, thus I do not find it feasible.
- I hope I helped, @Obsuser:, aegis maelstrom δ 18:00, 16 November 2016 (UTC)
- @Obsuser: Sorry for the late response. We had to prepare the articles for handing them over to the space team. The deadlines were set before they had to postpone the start of the rocket. Nevertheless, it is planned to start, with the disc, in the end of 2017 or early 2018. Sorry that you couldn't submit your article before the deadline! Any featured articles, however, will be a plus to Wikipedia. I'm looking forward to it! :-) Best, Martin Rulsch (WMDE) (talk) 11:11, 28 December 2016 (UTC)
Is this finished?
[edit]@Martin Rulsch (WMDE), Denis Schroeder (WMDE), Obsuser, and Aegis Maelstrom: Was this successful? Abandoned? This page needs an update. --Piotrus (talk) 04:03, 4 September 2018 (UTC)
- @Piotrus: Hi Piotrus. It is a good question. I am still hoping guys will deliver their post mortem - I can give you give an opinion of a space geek and a Wikimedia projects evaluator. Sorry @Martin Rulsch (WMDE), Denis Schroeder (WMDE), and Obsuser:, my POV and opinion remain unfavourable.
- To make things clear: evaluating this project requires naming it. If we consider it as a "PR stunt", the reviews may be mixed or favourable - many people heard about "some guys launching something to the Moon". However, if we consider it as an engineering project, it failed.
- Unfortunately, as predicted by Yours truly (and some other people), the Google Lunar X Prize competition and this particular entry turned to be sad yet unsurprising flops, alongside many other disappointments in this long story. Making it short: the Google Lunar X Prize was ill-fated from the beginning and the chances of success were negligible already in 2016, to be definitively shattered by 2017/2018. The "PT Scientists" entry to the competition was quitely phased out even earlier so, and it was clear for everyone at the point of the last competition time extention in 2016/2017.
- By the end of 2016 it got obvious that the "Part-Time Scientists" team is not going to meet a requirement to make it to the final round - the required milestone was "to obtain a rocket launch agreement - even if an extremely doubtful one". In January 2017 after an extra wait period it was announced that 5 teams made it to the final extension - and the "PT Scientists" team was not among them [15]. After a few months it got also obvious that none of the team would manage to launch early enough to land by 31st March, 2018 (deadline).
- Now, the deadline has passed and the competition is closed. Ofc, we cannot rule out that the team somehow revives, receives funding, know-how and whatnot and manages to launch something to the Moon. Good Luck with that. Unfortunately, it has not happened in the timeframe and a window of opportunity as proposed, and this window is closed.
- My personal beef with this project is, it has made people to work and debate about something destined to be irrelevant for any knowledgable spacegeek (and I believe we have a number of them among Wikimedians).
- For future, I would like to appreciate spacegeekism and "think-outside-of-the-box" attitude of the people involved, as well as their ability to make great PR or gather and inspire the community to run novel projects. In the same time, however, I must whine on manhours and high hopes wasted, and I would love to see a better feasability assessment in the very beginning of the projects. Consider me a conservatist but I find making promises like this for some PR morally wrong, and insulting me personally as a volunteer. We could have deliver something, which would be useful on top of that.
- For instance, should anyone want to run some project with a "frozen" release of Wikipedia in mind - there is such a thing as Kiwix. And you know what, their users could actually make use of this release of Wikipedia (comparing to Moon regolith).
- Best Regards with a healthy CEE criticism, aegis maelstrom δ 11:26, 4 September 2018 (UTC) @Doc James, Stephane (Kiwix), and Alleycat80:
- Thanks User:Aegis Maelstrom, for the update. While we may learn a bit more when other posts, if this is indeed tied to the Google Lunar X Prize, then clearly this failed (or at least stalled), and the page for this should reflect this, rather then speak in present/future tense "are planning to send their own custom-built rover to the Moon. And they want to take Wikipedia with them". They planned, they wanted, they failed. Decent PR stunt, now history of nice ideas that didn't work out. We should be clear about it. --Piotrus (talk) 11:30, 4 September 2018 (UTC)
- Yes, the other point of criticism would be that this project seemed to be unattended, not fully designed (what were the actual objectives and measures of success - other than sending something to the Moon?), unreported and abandoned/unfinished. We could agree that some PR, or some increase of editorship were the actual intended goals - however I fail to see any explicit mention of such goals or measuring them. Finally, any project deserves some closing and a summary - this is why I am still waiting for some word about later happennings.
- I don't want to overly blame people here, my understanding is that it was some personal initiative of a few volunteers (was it?) even if it was heavily endorsed eg. by Wikimedia Deutschland. My hope is making some lessons learned for the future. Happy wiki everyone, sorry if I am raining on your parade. :) aegis maelstrom δ 11:48, 4 September 2018 (UTC)
- Well as far as Kiwix is concerned they never reached out (we did initially, but never heard back; in any case it's not like they did not know where to find us). Stephane (talk) 14:14, 4 September 2018 (UTC)
- I would have preferred a project working towards "Wikipedia for the 3 Billion people without Internet access on Planet Earth"... We of course have one within Internet-in-a-Box/Kiwix/WP:MED/App but it can always use more support. Doc James (talk · contribs · email) 15:15, 4 September 2018 (UTC)
- Well as far as Kiwix is concerned they never reached out (we did initially, but never heard back; in any case it's not like they did not know where to find us). Stephane (talk) 14:14, 4 September 2018 (UTC)
- Thanks User:Aegis Maelstrom, for the update. While we may learn a bit more when other posts, if this is indeed tied to the Google Lunar X Prize, then clearly this failed (or at least stalled), and the page for this should reflect this, rather then speak in present/future tense "are planning to send their own custom-built rover to the Moon. And they want to take Wikipedia with them". They planned, they wanted, they failed. Decent PR stunt, now history of nice ideas that didn't work out. We should be clear about it. --Piotrus (talk) 11:30, 4 September 2018 (UTC)
Thanks for asking! The project is still running, the start had to be postponed to early 2019 though. As soon as we get more news from PT Scientist, we can let you know. In the mean time, we recommend you to follow their or our Facebook page. Best, Martin Rulsch (WMDE) (talk) 14:41, 6 September 2018 (UTC)
PTScientists has filed for bankruptcy protection earlier this month, still hoping to "emerge stronger from the insolvency proceedings and implement our lunar mission as planned." It's worth being aware though that during the last decade, the planned launch date seems to always have been 1-2 years in the future:
| Statement from ... | Expected launch |
|---|---|
| September 2009 | before the end of 2012 |
| May 2012 | "early 2014" |
| January 2015 | "Lift-off: Q3-2016" |
| January 2016 | "by the third quarter of 2017" |
| April 2016 | "the team even has a launch window: late 2017, aboard a commercial rocket" |
| November 2016 | "Probably between late 2017 and spring 2018" |
| November 2016 | "Ende 2017 oder Anfang 2018 soll die Rakete abheben." "... haben sich dafür nach eigener Angabe bei der US-Firma Spaceflight Industries eingekauft." |
| November 2018 | "could launch as soon as late 2019." |
| January 2019 | "launch not earlier than Q1 2020" |
| May 2019 | "set to launch to the Moon for the first time in 2021" |
Regards, HaeB (talk) 10:14, 20 July 2019 (UTC)
SpaceIL Beresheet mission
[edit]I just saw https://www.archmission.org/spaceil (via Slashdot story with other links) which might be of interest to folks here. TLDR: It's carrying a copy of (just) the English Wikipedia (a full copy of the mid 2017 dumps in digital XML format, plus PDFs of the 12,000 Vital articles in both digital and as analogue etchings). However the (PDF warning) overview document (see pages 52 & 54) says "Text and XML dumps only; media resources to be delivered on subsequent missions" -- so maybe someone could get in touch to help them make the decision to include all the other languages in any followup missions?
A little more info at w:SpaceIL#Beresheet lander (d:Q61742389). If all goes well it will land on the moon on 11 April. :-) Quiddity (talk) 10:58, 27 February 2019 (UTC)
- Beresheet ended in a crash landing, but according to this post, its copy of the English Wikipedia's Vital articles can be assumed to have survived and "will last up to 5 billion years". Regards, HaeB (talk) 09:38, 20 July 2019 (UTC)
- Cool. Not the same project though: Wikipedia Signpost suggestst that the WttM has filed for bankruptcy?. --Piotrus (talk) 07:33, 14 September 2020 (UTC)
