close
Skip to main content
Nature Portfolio logoLink to Nature Portfolio
. 2026 Feb 18;651(8106):785–795. doi: 10.1038/s41586-026-10113-6

In vivo base editing of Chd3 rescues behavioural abnormalities in mice

Kan Yang 1,2,3,✉,#, Wei-Ke Li 4,#, Yi-Xiao Geng 2,5,#, Shu-Qian Zhang 6,#, Shi-Hao Wu 7,#, Yan-Bo Cheng 8,9,#, Jun-Wen Wang 2, Zhan-Kui Xu 3, Wen-Xin Wang 2,10, Tan-Ying Zhang 3, Pei-Ye Wang 2,5, Yi-Ting Yuan 2, Juan Fan 3, Jun Wu 2, Ruo-Chuan Xu 5, Yue-Fang Zhang 2, Gong-Jia Tao 2, Zheng-Hui Li 11, Chen-Xi Lin 5, Tian-Shu Li 2, Xin-Yi Zhang 4, Jie Li 4, Ru Zhang 3, Wen-Xiu Yang 7, Jia-Shuo Wen 7, Zun-Yuan Yang 12, Li Gong 12, Wen Zeng 12, Ai-Lian Du 2, Jin-Song Li 8,9, Fei Li 1,, Tian-Lin Cheng 4,, Zilong Qiu 1,2,
PMCID: PMC12999480  PMID: 41708849

Change history

7/29/2026

Editor’s Note: Readers are alerted that concerns have been raised regarding this article, including with the data presented. Further editorial action will be taken if appropriate as soon as the investigation into the concerns is complete and all parties have been given an opportunity to respond in full.

Abstract

Neurodevelopmental disorders that arise from de novo mutations in chromatin-remodelling genes lack targeted treatments. Snijders Blok–Campeau syndrome (SNIBCPS)1, which is caused by pathogenic variants in CHD3, manifests with intellectual disability, autistic-like behaviours and motor deficits2. Whether somatic gene correction can reverse such phenotypes in vivo remains unknown. Here we show that modelling the recurrent CHD3 variant p.R1025W in a humanized mouse model (Chd3 hR1025W/+) recapitulates key features of SNIBCPS, including reduced CHD3 protein levels and abnormalities in social communication, cognition and motor coordination. We engineered a TadA-embedded adenine base editor (TeABE) and delivered it brain-wide using a dual adeno-associated virus (AAV) system and achieved efficient on-target A•T-to-G•C correction across multiple cortical and hippocampal regions with minimal bystander activity. This intervention restored CHD3 levels and ameliorated behavioural abnormalities in vivo. Furthermore, intrathecal dual AAV delivery in nonhuman primates resulted in widespread neuronal transduction and efficient TeABE reconstitution, a result that supports its translational feasibility. These findings establish in vivo base editing as a viable therapeutic approach for CHD3-related neurodevelopmental disease. More broadly, they demonstrate that precise single-base correction in the postnatal brain can restore protein dosage and function, thereby offering a framework for the treatment of monogenic neurodevelopmental disorders.

Subject terms: Targeted gene repair, Developmental disorders


In vivo base editing of a causative mutation that leads to the neurodevelopmental disorder Snijders Blok–Campeau syndrome restores protein dosage and ameliorates molecular and behavioural deficits in a humanized mouse model of the condition.

Main

SNIBCPS (Online Mendelian Inheritance in Man identifier 618205) is an autosomal-dominant genetic disorder caused by pathogenic mutations in the gene that encodes chromodomain helicase DNA-binding protein 3 (CHD3). The disorder was first described by Lot Snijders Blok in 2018 (ref. 1), and more than 100 cases have since been reported2,3. The primary clinical features of SNIBCPS include global developmental delay, speech delay, intellectual disability, hypotonia, abnormal facial features and structural brain anomalies, and are frequently accompanied by autism spectrum disorder (ASD)1,2,47. Although most cases are caused by single-nucleotide variants (SNVs), one instance involving a complete deletion and duplication of CHD3 has been documented6.

The CHD protein family is crucial for chromatin remodelling and relies on ATP hydrolysis to regulate chromatin structure and gene transcription8,9. Members of this family are implicated in various neurodevelopmental disorders, including CHD2 in epilepsy10, CHD7 in CHARGE syndrome11 and CHD8 in ASD12. CHD3, along with CHD4 and CHD5, forms a core component of the nucleosome remodelling and deacetylase (NuRD) complex that modulates chromatin structure and DNA accessibility and has vital roles in cell cycle regulation and embryonic stem cell differentiation1318. CHD3 is essential for cerebral cortex development, as its deficiency results in defects in cortical neuron differentiation and migration19. Furthermore, CHD3 mutations have been linked to childhood apraxia of speech20,21. Most pathogenic SNVs in CHD3 occur in the helicase ATP-binding and carboxy-terminal domains, which are crucial for its function. Although mutations in the ATP-binding domain may disrupt ATP hydrolysis and chromatin remodelling, this mechanism does not fully explain the diverse effects of all known SNVs associated with SNIBCPS1.

The advent of CRISPR–Cas9 technology has revolutionized gene editing22,23. However, the potential for DNA double-strand breaks caused by CRISPR–Cas9 to induce genomic damage poses limitations. Base editing is an optimized approach that enables precise single-base editing without DNA double-strand breaks2426. Cytosine base editors (CBEs) can convert C•G to T•A, whereas adenine base editors (ABEs) can convert A•T to G•C25,26. This technology has demonstrated efficacy in vivo, with base-editing gene therapy showing success in Hutchinson–Gilford progeria syndrome, spinal muscular atrophy, ASD, genetic heart and retinal disease in mouse models2732.

Here we model a recurrent de novo CHD3 variant associated with SNIBCPS—c.C3073T (NM_001005271.3), p.R1025W (NP_001005271.2)—which accelerates CHD3 protein degradation. We generated a humanized mouse model (Chd3 hR1025W/+) that exhibits deficits in communicative vocalization, cognition and autism-relevant behaviours. To correct the genetic mutation in vivo, we engineered a TeABE to convert the mutant A•T base pair and delivered it to the brain using a dual-AAV system via intravenous injection, an approach that enabled effective penetration across the blood–brain barrier. TeABE editing restored CHD3 protein levels and ameliorated behavioural abnormalities in Chd3 hR1025W/+ mice. In nonhuman primates (NHPs), intrathecal delivery of AAV9 vectors encoding a TeABE achieved broad brain transduction and editor reconstitution, a result that supports its translational feasibility. Together, these findings indicate that in vivo base editing may be a viable strategy to mitigate SNIBCPS-relevant phenotypes and highlight the clinical potential of base editors for treating genetic neurodevelopmental disorders.

De novo SNV of CHD3 in SNIBCPS

To summarize CHD3 variants found in individuals with SNIBCPS33, a schematic of locations of genetic mutations in CHD3 is shown in Fig. 1a and Supplementary Table 1. The amino acid change R1025W is caused by recurrent de novo variants located between the helicase ATP-binding domain and the helicase C-terminal domain of the CHD3 protein (Fig. 1a). This variant (c.C3073T, NM_001005271.3) is absent in East Asian populations in the gnomAD database (http://gnomad.broadinstitute.org), which suggests that it is a rare variant.

Fig. 1. The recurrent de novo CHD3(R1025W) variant destabilizes CHD3.

Fig. 1

a, Schematic of reported de novo variants in CHD3 (NP_001005271.2), highlighting the recurrent p.R1025W mutation associated with SNIBCPS. The asterisk denotes a premature termination codon. PHD, plant homeodomain; Chromo, chromodomain; DUF, domain of unknown function. b, Immunoblot (left) and quantification (right) of Flag-tagged human CHD3(WT) and CHD3(R1025W) expressed in primary cortical neurons (P = 0.0113, n = 6 biologically independent samples from 3 independent experiments; unpaired two-sided t-test). GAPDH was used as the loading control. c, Quantification of Flag-tagged CHD3 WT and CHD3 R1025W mRNA levels in primary neurons by quantitative PCR (qPCR) (n = 4 biologically independent samples; unpaired two-sided t-test). d, Immunoblot (left) and quantification (right) of CHX (20 μg ml–1) chase in HEK293T cells expressing CHD3(WT) or CHD3(R1025W), showing accelerated degradation of the mutant protein (P = 0.0187, n = 3 independent experiments; two-way analysis of variance (ANOVA) with Šidák’s multiple-comparisons test). To match initial band intensities for comparison, the exposure time for CHD3(R1025W) was increased. e, Immunoblot (left) and quantification (right) of CHD3(WT) and CHD3(R1025W) in HEK293T cells treated for 12 h with dimethyl sulfoxide (DMSO), CHX (20 μg ml–1) or the proteasome inhibitor BTZ (100 nM) (P = 0.0152, CHD3(WT) + DMSO versus CHD3(R1025W) + DMSO; P = 0.0083, CHD3(R1025W) + DMSO versus CHD3(R1025W) + BTZ; n = 3 independent experiments; unpaired two-sided t-test). f, Immunoblot (left) and quantification (right) of Flag–CHD3(WT) and Flag–CHD3(R1025W) co-expressed at varying ratios in HEK293T cells (P = 0.0499, 2 μg vector + 1 μg CHD3(WT) versus 1 μg vector + 1 μg CHD3(WT) + 1 μg CHD3(R1025W); P = 0.0008, 2 μg vector + 1 μg CHD3(R1025W) versus 1 μg vector + 1 μg CHD3(WT) + 1 μg CHD3(R1025W); n = 6 independent experiments; unpaired two-sided t-test).See Supplementary Table 5 for complete P values for e and f. Data are the mean ± s.d.; *P < 0.05, **P < 0.01, ***P < 0.001.

Source Data

We obtained a mRNA expression profile of CHD3 from the BrainSpan Atlas of Developing Human Brain (http://www.brainspan.org) that covered the period from embryonic development to adulthood34. CHD3 is highly expressed in the striatum (STR), anterior cingulate (ACC), hippocampus (Hip), cerebellar cortex (CBC), medial prefrontal cortex (mPFC) and primary motor cortex (M1C) (Extended Data Fig. 1a). In mice, the protein level of CHD3 in the brain gradually declined from embryonic development to adulthood (Extended Data Fig. 1b).

Extended Data Fig. 1. Characterization of the SNIBCPS associated CHD3 mutation leading to protein degradation.

Extended Data Fig. 1

a, CHD3 transcript levels in the human brain. Data from the Human Brain Transcriptome (https://www.brainspan.org/). b, Immunoblotting and quantitative analysis of CHD3 protein in mouse brain as the mouse development (P = 0.0047 (E12.5 vs P14), P = 0.001 (E12.5 vs 3 M), n = 3 independent experiments, unpaired two-side t-test). c, Immunoblotting of human CHD3-WT/R1025W expressed in HEK293T cells and quantitative analysis of mRNA and protein (P = 0.0104, n = 6 biological replicates from 3 independent experiments, unpaired two-side t-test). d, Quantitative analysis of mRNA of human CHD3-WT/R1025W expressed in HEK293T cells by qPCR (n = 4 biological replicates, unpaired two-side t-test). e, The measurement patterns of endogenous and exogenous CHD3 mRNA. Different primers were used for identification. Quantitative analysis of expression of exogenous (f) (P = 0.0002 (GFP vs CHD3-WT-GFP), P = 0.0007 (GFP vs CHD3-R1025W-GFP), n = 3 independent experiments, unpaired two-side t-test) and endogenous (g) CHD3 mRNA in primary neurons. h, Arginine (Arg, R) replaced by three aromatic amino acid, tryptophan (Trp, W), phenylalanine (Phe, F) and tyrosine (Tyr, Y). i, Predicted structure of CHD3-WT/R1205W/R1025F/R1025Y using Alphafold3 (ref. 35). Enlarged diagram illustrates the connectivity between key functional domains. Blue: Helicase ATP binding domain; Orange: Helicase C-terminal domain; Red: mutant amino acid; Green: other amino acid. j, Immunoblotting of human CHD3-WT/R1025W/R1025F/R1025Y expressed in HEK293T cells and quantitative analysis of protein (P = 0.0069 (WT vs R1025W), P = 0.0371 (WT vs R1025F), P = 0.03 (WT vs R1025Y), n = 4 independent experiments, unpaired two-side t-test). k, Quantitative analysis of mRNA of human CHD3-WT/R1025W/R1025F/R1025Y by qPCR in j. l, Fluorescence imaging and intensity analysis (orange dashed line) of human CHD3-WT/R1025W/R1025F/R1025Y. m, Quantitative analysis of mean fluorescence intensity shown in l (P < 0.0001 (WT vs R1025W), P < 0.0001 (WT vs R1025F), P < 0.0001 (WT vs R1025Y), n = 31 cells (WT), 33 cells (R1025W), 36 cells (R1025F), 32 cells (R1025Y) from 4 independent experiments, unpaired two-side t-test). Statistical values represent the mean ± S.D. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. The schematic in e was created using BioRender (https://biorender.com).

Source Data

To determine whether the R1025W variant affects normal function of the CHD3 protein, we examined the expression level of Flag-tagged human wild-type CHD3 (CHD3(WT)) and the mutant protein (CHD3(R1025W)) in mouse cortical neurons and in HEK293T cells. The protein level of human CHD3(R1025W) was lower than that of human CHD3(WT) (Fig. 1b and Extended Data Fig. 1c). However, the mRNA levels of transfected human CHD3(WT) and CHD3(R1025W) remained the same (Fig. 1c and Extended Data Fig. 1d), which indicated that the R1025W variant affects CHD3 protein levels.

After cycloheximide (CHX) treatment, an inhibitor of protein translation, the levels of CHD3(R1025W) protein decreased faster than CHD3(WT), which indicated that the R1025W mutation accelerated CHD3 protein degradation (Fig. 1d). Treatment with the proteasome inhibitor bortezomib (BTZ) restored the levels of CHD3(R1025W) protein, which indicated that degradation of CHD3(R1025W) protein is mediated by a ubiquitin-dependent pathway (Fig. 1e).

To examine whether CHD3(R1025W) is a dominant-negative variant, we co-transfected CHD3(R1025W) with various doses of CHD3(WT) in cultured cells (Fig. 1f). Expression of CHD3(R1025W) along with CHD3(WT) did not reduce the total level of CHD3 protein, which strongly suggests that CHD3(R1025W) acts in a loss-of-function manner rather than exerting a dominant-negative effect (Fig. 1f and Extended Data Fig. 1e–g).

To further investigate the importance of R1025 for CHD3 protein stability, we determined the impact of all aromatic amino acids, namely tryptophan, phenylalanine and tyrosine, on its structure (Extended Data Fig. 1h). Modelling based on Alphafold3 (ref. 35) suggests that there is a possible alteration in the relative orientation between the helicase and C-terminal domains in the R1025W, R1025F and R1025Y variants of CHD3, although this observation is qualitative and requires future experimental validation (Extended Data Fig. 1i). R1025W, R1025F and R1025Y all led to decreased levels of CHD3 protein (Extended Data Fig. 1j,k). Similarly, substitution of aromatic amino acids in R1025 led to marked decreases in the immunofluorescence intensity of CHD3 in the nucleus of HEK293T cells (Extended Data Fig. 1l,m), which indicated that R1025 is crucial for CHD3 protein stability, but has no influence on mRNA levels.

CHD3(R1025W) impairs neuron morphology

To further explore the influence of CHD3(R1025W) on neuronal morphology, we constructed short hairpin RNAs (shRNAs) that specifically target mouse Chd3 (Extended Data Fig. 2a). The knockdown efficiency of three designed shRNAs was tested by measuring endogenous Chd3 mRNA levels in mouse cortical neurons (Extended Data Fig. 2b). The expression of endogenous CHD3 protein was effectively reduced by all of the shRNAs (Extended Data Fig. 2c,d). Knockdown of Chd3 in cultured mouse cortical neurons led to decreased dendritic length and branch numbers at both 3 and 7 days in vitro, but had no significant impact on axons (Extended Data Fig. 2e–k). These abnormalities were restored through co-transfection of a shRNA-resistant CHD3(WT) construct but not CHD3(R1025W) (Extended Data Fig. 2e–k). These findings indicate that CHD3 is important for neuronal growth and that the R1025W mutation hampers dendritic morphology.

Extended Data Fig. 2. CHD3-R1025W mutation hampers dendritic growth of culture neurons.

Extended Data Fig. 2

a, Schematic representation of the three constructed shRNAs targeting the mouse Chd3 gene. b, Quantitative analysis of CHD3 mRNA levels in mouse cortical neurons in the presence of sh1, sh2, sh3 or scramble (P = 0.0005 (Scramble vs sh1), P = 0.0031 (Scramble vs sh2), P = 0.0007 (Scramble vs sh3), n = 4 independent experiments, unpaired two-side t-test). c, Immunoblotting of CHD3 in mouse cortical neurons in the presence of sh1, sh2, sh3 or all or scramble. d, Quantitative analysis of the CHD3 expression shown in c (P = 0.0015 (Scramble vs sh1 + sh2 + sh3), P = 0.0011 (Scramble vs sh1), P = 0.0084 (Scramble vs sh2), P = 0.0048 (Scramble vs sh3), n = 3 independent experiments, unpaired two-side t-test). e, Protocol for in vitro culture, transfection and observation of primary mouse neurons. f, Immunofluorescence images of mouse primary neurons transfected into vector, CHD3-WT, CHD3-R1025W and co-transfected with shRNA-2 at day 3. Scale bar, 50 µm. Statistical results of total axonal length (g) and axonal branch number (h) of transfected primary mouse neurons in f. Each dot represents a neuron. i, Immunofluorescence images of mouse primary neurons transfected into vector, CHD3-WT, CHD3-R1025W and co-transfected with shRNA-2 at day 7. Scale bar, 25 µm. Statistical results of total dendritic length (j) (P = 0.0009 (Vector vs CHD3-WT), P < 0.0001 (Vector vs Vector + CHD3-shRNA-2), P < 0.0001 (Vector vs CHD3-R1025W + CHD3-shRNA-2), P = 0.0006 (CHD3-WT vs CHD3-R1025W), P < 0.0001 (Vector + CHD3-shRNA-2 vs CHD3-WT + CHD3-shRNA-2), P < 0.0001 (CHD3-WT + CHD3-shRNA-2 vs CHD3-R1025W + CHD3-shRNA-2), Vector, CHD3-R1025W, CHD3-R1025W + CHD3-shRNA-2: n = 11 neurons; CHD3-WT: n = 13 neurons; CHD3-WT + CHD3-shRNA-2, CHD3-WT + CHD3-shRNA-2: n = 10 neurons, unpaired two-side t-test) and dendritic branches number (k) (P = 0.0017 (Vector vs CHD3-WT), P = 0.0002 (Vector vs Vector + CHD3-shRNA-2), P = 0.003 (Vector vs CHD3-R1025W + CHD3-shRNA-2), P = 0.0003 (CHD3-WT vs CHD3-R1025W), P = 0.0002 (Vector + CHD3-shRNA-2 vs CHD3-WT + CHD3-shRNA-2), P = 0.0022 (CHD3-WT + CHD3-shRNA-2 vs CHD3-R1025W + CHD3-shRNA-2), Vector, CHD3-R1025W, CHD3-R1025W + CHD3-shRNA-2: n = 11 neurons; CHD3-WT: n = 13 neurons; CHD3-WT + CHD3-shRNA-2, CHD3-WT + CHD3-shRNA-2: n = 10 neurons, unpaired two-side t-test) of transfected primary mouse neurons in i. Statistical values represent the mean ± S.D. **P < 0.01, ***P < 0.001, ****P < 0.0001. The schematics in a and e were created using BioRender (https://biorender.com).

Source Data

Reduced CHD3 and behaviour change in Chd3hR1025W/+ mice

To investigate the role of CHD3(R1025W) in the pathogenesis of SNIBCPS, we generated a humanized knock-in mouse (Chd3 hR1025W/+) through CRISPR–Cas9-mediated homology-directed repair. We introduced a locally humanized sequence with the R1025W substitution at the orthologous Chd3 locus (human CHD3 R1025, NP_001005271.2, which corresponds to mouse R1018, NP_ 666131.3) (Fig. 2a and Extended Data Fig. 3a,b).

Fig. 2. Chd3hR1025W/+ mice recapitulate SNIBCPS-like behavioural abnormalities.

Fig. 2

a, Strategy for generating Chd3 hR1025W/+ knock-in mice. A 34-bp humanized sequence with the R1025W variant was introduced into the mouse Chd3 locus. The red arrow marks the mutant base and black arrows indicate additional human-specific bases. Underlined bases indicate the 20-nucleotide target sequence recognized by the sgRNA. b,c, Immunoblot (b) and quantification (c) of CHD3 in the PFC, ACC, RSC and Hip from Chd3 +/+ and Chd3 hR1025W/+ mice (P = 0.0095 (PFC), P = 0.0114 (ACC), P = 0.0004 (RSC), P = 0.0058 (Hip); n = 4 mice per group; unpaired two-sided t-tests). d, Representative USV traces from postnatal day 3 (P3) pups after maternal separation. eg, USV number (e), call duration (f) and call-type distribution (g) in Chd3 +/+ and Chd3 hR1025W/+ pups (e, P = 0.0043, n = 7 mice per group; f, P < 0.0001, 105 calls from 7 Chd3 +/+ pups and 73 calls from 7 Chd3 hR1025W/+ pups; g, P < 0.0001 (complex), P = 0.0036 (trailing), P = 0.0029 (U-shape), P = 0.0065 (down), P = 0.0053 (flat), P = 0.0087 (short); n = 7 mice per group). h, Schematic (top) and locomotion heatmaps (bottom) for the novel object (NO) recognition test. O1, object 1. i,j, Exploration time for a familiar object (O1) versus a novel object (i) and preference index (j) (i, P < 0.0001; j, P = 0.0169; n = 12 mice per group). k, Schematic (top) and heatmaps (bottom) for the three-chamber social novelty test. F1, familiar 1; S2, stranger 2. l,m, Time spent sniffing (l) and the social preference index (m) (l, P < 0.0001; m, P = 0.0205; n = 12 mice per group). n,o, Representative images (n) and quantification (o) of marbles buried in 10 min (P = 0.0041; n = 12 mice per group). p, Self-grooming time during 30 min (P < 0.0001; n = 12 mice per group). Data are the mean ± s.d.; unpaired two-side t-test, * P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. The schematics in a, h and k were created using BioRender (https://biorender.com).

Source Data

Extended Data Fig. 3. Validation of decreased protein levels in Chd3hR1025W/+ mice.

Extended Data Fig. 3

a, Schematic illustration of the hR1025W knock-in and breeding strategy for Chd3 hR1025W/+ mice. b, Sequencing validation results for the genotypes of the Chd3 hR1025W/+ mutant mice. c, Immunoblotting and quantitation of CHD3 protein levels in Chd3 +/+ and Chd3 hR1025W/+ mice (P = 0.0014 (CB), P = 0.0031 (OB), n = 4 independent experiments, unpaired two-side t-test). CB, cerebellum; OB, olfactory bulb. d, Immunohistochemical staining and quantitation of fluorescence for CHD3 (red) and 4,6-diamidino-2-phenylindole (DAPI) (nuclei marker, blue) in the cerebral cortex and hippocampus of Chd3 +/+ and Chd3 hR1025W/+ mice (P < 0.0001 (RSC), P = 0.0005 (PtA), P < 0.0001 (S1Tr), P < 0.0001 (S1BF), P < 0.0001 (CA1), P < 0.0001 (CA2), P < 0.0001 (CA3), P < 0.0001 (DG), n = 12 slices from 4 mice of each genotype; 3 slices per mouse, unpaired two-side t-test). PtA, parietal association cortex; S1Tr, primary somatosensory cortex trunk area; S1BF, primary somatosensory cortex barrel field area; CA1, cornu ammonis 1; CA2, cornu ammonis 2; CA3, cornu ammonis 3; DG, dentate gyrus. e, Schematic representation of mice behavioral experiments in Fig. 2 and sampling time points. Statistical values represent the mean ± S.D. **P < 0.01, ***P < 0.001, ****P < 0.0001. The schematics in a and e were created using BioRender (https://biorender.com).

Source Data

CHD3 protein levels in Chd3 hR1025W/+ mice were largely decreased in various brain regions compared with wild-type (WT) mice (Fig. 2b,c and Extended Data Fig. 3c). As CHD3 is widely expressed in the cortex and hippocampus, immunohistochemical staining was performed to examine the expression of CHD3 in the brains of Chd3 hR1025W/+ mice. The fluorescence intensity of CHD3 signals in Chd3 hR1025W/+ mice was reduced in the retrosplenial cortex (RSC), parietal association cortex (PtA), primary somatosensory cortex trunk area (S1Tr), primary somatosensory cortex barrel field area (S1BF), hippocampal regions CA1, CA2 and CA3 and dentate gyrus (DG) compared with WT mice (Extended Data Fig. 3d).

As nearly 90% of individuals with SNIBCPS present with speech disorders, we conducted infant ultrasonic vocalization (USV) tests on Chd3 hR1025W/+ newborn pups after maternal separation (Extended Data Fig. 3e). Chd3 hR1025W/+ pups vocalized less frequently and for shorter durations compared with their WT littermates (Fig. 2d–f). Moreover, these pups produced fewer U-shaped inverted and complex vocalizations, which are indicative of a dysphonia-like disorder (Fig. 2g).

Given that over 70% of individuals with SNIBCPS experience intellectual disabilities, we assessed whether the Chd3 hR1025W mutation impaired cognitive functions in mice. In the novel object recognition test, Chd3 hR1025W/+ mice spent significantly less time exploring novel objects and exhibited a reduced recognition preference index, a finding that indicated impaired cognitive recognition abilities (Fig. 2h–j). As more than 30% of individuals with SNIBCPS exhibit traits associated with ASD, we further examined autistic-like behaviours in Chd3 hR1025W/+ mice, with a focus on social interactions and repetitive stereotypical behaviours. In the three-chamber test, mutant mice showed a significant reduction in social novelty preference, which indicated impaired social behaviours (Fig. 2k–m). Moreover, marble-burying and self-grooming tests revealed markedly increased repetitive stereotyped behaviours compared with their WT littermates (Fig. 2n–p). Collectively, these results show that Chd3 hR1025W/+ mice recapitulate core behavioural abnormalities observed in SNIBCPS, including dysphonia, intellectual disability and autistic-like traits.

Design of the Tad-embedded ABE

To screen various TeABE–sgRNA combinations and to identify the most efficient tool for correcting Chd3 hR1025W, we established a human CHD3 R1025W/R1025W cell line using AeCBE-mediated base editing32. Initially, we designed two candidate sgRNAs (C10 and C11) (Extended Data Fig. 4a) and two CBE variants (Extended Data Fig. 4b) using the cytidine deaminases APOBEC3A(Y130F) and LpCDA1L1_1 (refs. 29,36,37), respectively. These combinations were transfected into HEK293T cells followed by selection of positive monoclonal colonies based on puromycin resistance (Extended Data Fig. 4c). Successful construction of the point-mutation cell line was confirmed by Sanger sequencing (Extended Data Fig. 4d), and a CHD3 R1025W/R1025W homozygous cell line was identified (Extended Data Fig. 4e) that showed no detectable bystander editing effects.

Extended Data Fig. 4. Design of TadA-embedded ABE.

Extended Data Fig. 4

a, Design of candidate sgRNAs (sgRNA-C10, sgRNA-C11) for CHD3 point mutation cell line generation. Arg (CGG), targeting amino acid. b, Illustration of the candidate sgRNAs and CBEs for constructing the CHD3 point mutation cell line. c, Workflow for the screening of the point mutation cell line. d, Sanger sequencing chromatogram of the HEK293T cell genome after transient transfection with sgRNA and CBEs. e, Sanger sequencing chromatogram of the HEK293T cell line genome of two representative monocolony after 4 days of puromycin treatment. The red box (C > T) in the figure indicates the target base position (d and e). f, Design of candidate sgRNAs for correcting CHD3-R1025W mutation. g, Schematic diagram of the candidate sgRNA and adenine base editor for repairing the CHD3-R1025W point mutation. h, A flowchart for screening the base editing efficiency of multiple sgRNA and ABE combinations. i, Quantification of on-target base editing efficiency and by-stander effects for different candidate sgRNAs (P = 0.0016 (sgRNA-A10 A10 vs A12), P = 0.0032 (sgRNA-A11 A11 vs A13), n = 3 independent experiments, unpaired two-side t-test). Bold labels stand for on-target sites. j, Quantification of the on-target editing (A11) and bystander editing (A13) of the various TeABE editors (P = 0.0004 (A13 TeABE-1249 vs TeABE-1248(Δ1249-1264)), n = 3 independent experiments, unpaired two-side t-test). k, GUIDE-seq using WT-SpCas9 with the CHD3-targeting sgRNA to identify potential Cas9-targeting sites. l, Quantification of on-target editing and off-targeting effects for TeABE-1249 and TeABE-1248(Δ1249-1264) (P = 0.0333 (On-A11 TeABE-1249 vs TeABE-1248(Δ1249-1264)), P = 0.0003 (On-A13 TeABE-1249 vs TeABE-1248(Δ1249-1264)), P = 0.0001 (OT3-A11 TeABE-1249 vs TeABE-1248(Δ1249-1264)), P = 0.0002 (OT3-A13 TeABE-1249 vs TeABE-1248(Δ1249-1264)), n = 3 independent experiments, unpaired two-side t-test). Statistical values represent the mean ± S.D. *P < 0.05, **P < 0.01, ***P < 0.001. The schematics in ac and fh were created using BioRender (https://biorender.com).

Source Data

Next, we designed sgRNAs that spanned the target window (A4–A15; Extended Data Fig. 4f) and built a panel of TeABE variants by embedding the TadA*(LOF)–TadA*(F148A) dimer—an inactive TadA scaffold plus an F148A unit with reduced RNA off-targeting—at internal positions of SpCas9 backgrounds. This approach produced ABE-SpG-N, TeABE-SpG-535 and TeABE-nSpCas9/SpG-1249 (TeABE-1249)38 (Extended Data Fig. 4g). We then prioritized five guides (A4, A10, A11, A13 and A15) that placed the target adenine at distinct registers in canonical ABE windows while meeting PAM constraints (NGG for nSpCas9 and NG for SpG). ABE–sgRNA pairings were chosen a priori on the basis of PAM compatibility and coverage of the intended adenine to avoid bias from sgRNAs lying outside the activity window of the ABE. ABE-SpG-N and TeABE-SpG-535 (windows encompassing A4) were tested with sgRNA-A4, whereas TeABE-nSpCas9-1249 and TeABE-SpG-1249 (windows spanning A5–A15) were tested with sgRNA-A10, sgRNA-A11, sgRNA-A13 and sgRNA-A15 (illustrated in Supplementary Table 2).

These sgRNA and ABE combinations were transfected into the CHD3 R1025W/R1025W cell line, and double-positive cells were subjected to fluorescence-activated cell sorting (FACS) 72 h after transfection (Extended Data Fig. 4h and Supplementary Fig. 2a). Among all combinations, TeABE-1249 + sgRNA-A11 and TeABE-nSpG-1249 + sgRNA-A10 produced robust on-target editing (>40%) at their respective target adenines (Extended Data Fig. 4i). However, TeABE-nSpG-1249 + sgRNA-A10 produced disproportionately high bystander editing at A12 (exceeding A10 correction), whereas TeABE-1249 + sgRNA-A11 showed a lower—but still substantial—bystander edit at A13 (around 40%), despite its strong A11 correction. We therefore prioritized TeABE-1249 + sgRNA-A11 for subsequent optimization, with the aim of narrowing the editing window and suppressing bystander activity (Extended Data Fig. 4i).

To minimize bystander editing, we systematically evaluated editing efficiency at A11 and A13 across a series of newly designed TeABE variants (Extended Data Fig. 4j). Notably, TeABE-1248 (Δ1249–1263) achieved the highest efficacy at A11 while significantly reducing editing at A13 (Extended Data Fig. 4j). To test generalizability beyond these loci, we benchmarked TeABE-1248 (Δ1249–1263) against TeABE-1249 at 20 endogenous targets in HEK293T cells (endo sites 1–18, HPRT exon 6 and exon 8; Supplementary Table 3). Across this panel, TeABE-1248 (Δ1249–1263) reproducibly exhibited a narrowed editing window (A9–A14) relative to TeABE-1249 (A6–A15), with windows defined by >20% A-to-G editing (Supplementary Fig. 2b), which indicated that it had enhanced spatial precision across multiple sequence contexts.

To further examine the specificity of TeABE-1248 (Δ1249–1263), we quantified Cas9-dependent off-target editing at five validated off-target sites (HPRT exon 6 at OT1, OT2, OT3 and OT5 and HPRT exon 8 at OT1; Supplementary Table 3) and observed consistently lower off-target editing with TeABE-1248 (Δ1249–1263) (Supplementary Fig. 2c). To evaluate potential Cas9-independent activity, we performed R-loop assays at 6 loci (R-loops 1–6) and observed TeABE-1248 (Δ1249–1263) editing near background levels across all substrates (Supplementary Fig. 2d). Together with the multilocus benchmarking data, these results show that TeABE-1248 (Δ1249–1263) has broadly improved editing precision and specificity relative to TeABE-1249. This improvement is probably attributed to the removal of flexible sequences around the 1249 insertion site, which otherwise increases TadA access to mismatched off-target sites. To assess the off-target potential of TeABE variants, we performed GUIDE-seq analysis and identified three potential off-target sites (Extended Data Fig. 4k). Further analysis revealed that TeABE-1248 (Δ1249-1263) substantially minimized off-target editing, particularly at the OT3 site (Extended Data Fig. 4l).

To determine whether the bystander edit (A13→G; L1024P) affects the function of CHD3, we expressed human CHD3 variants (WT, R1025W, L1024P and L1024P + R1025W) in mouse primary neurons. CHD3(R1025W) led to markedly reduced CHD3 levels relative to CHD3(WT), whereas CHD3(L1024P) alone was comparable to CHD3(WT). Meanwhile, the CHD3(L1024P + R1025W) double mutant resembled CHD3(R1025W) (Supplementary Fig. 3a,b). We next measured dendritic branches and lengths in neurons expressing the CHD3 variants and with endogenous mouse Chd3 knocked down by shRNA. Only CHD3(WT) and CHD3(L1024P) were able to rescue the decreased dendritic branches and lengths caused by Chd3 knockdown. This result strongly suggests that CHD3(L1024P) may not affect the normal function of CHD3 (Supplementary Fig. 3c–e). Together, these data indicate that the A13 bystander variant L1024P may not exacerbate the abnormal phenotype caused by R1025W. On the basis of these findings, we selected TeABE-1248 (Δ1249–1263) as the optimized tool for subsequent in vivo base-editing experiments in Chd3 hR1025W/+ mice.

In vivo base editing by TeABE in mice

To benchmark CNS delivery and editor reconstitution, we administered dual AAV-PHP.eB-TeABE vectors at two dose levels and co-injected AAV-hSyn-GFP via the tail vein in mice. GFP reporter expression was widespread throughout the brain, which indicated efficient transduction (Fig. 3a). We then assessed editor expression and intein-mediated reconstitution by immunoblotting whole-brain lysates with an antibody against the Cas9 N terminus. At the higher dose, TeABE was robustly expressed and the fraction of full-length, reconstituted Cas9 (about 180 kDa) relative to the total Cas9 signal (full-length plus the amino-terminal fragment) reached around 80% (Extended Data Fig. 5a–c). On the basis of this reconstitution efficiency, we used the high-dose regimen for subsequent in vivo studies.

Fig. 3. TeABE restores CHD3 levels in the Chd3hR1025W/+ mouse brain.

Fig. 3

a, Left, schematic of dual AAV split-TeABE delivery and experimental timeline for tail-vein injection and tissue collection for NGS. Right, representative immunofluorescence image showing widespread transduction (hSyn-GFP, green; DAPI, blue). TIV, tail vein intravenous injection; ITR, inverted terminal repeat; NLS, nuclear localization signal; pU6, U6 promoter. b, Region-resolved NGS quantification of on-target (A11) and bystander (A13) editing across brain regions after high-dose TeABE (100 μl of 5.0 × 1012 vector genome (vg) per ml per vector + 10 μl AAV-hSyn-GFP; n = 3 mice). A11 editing rates (NT-TeABE brain versus TeABE RSC (P = 0.0294), versus TeABE Hip (P = 0.0422), versus TeABE ACC (P = 0.0107), versus TeABE OB (P = 0.0392), versus TeABE PFC (P = 0.0211), versus TeABE CB (P = 0.0282); unpaired two-sided t-tests; mean ± s.e.m.). NS, not significant c, Ratio of correction-only alleles (A11 edited without A13) to correction + bystander alleles (A11 + A13) from the datasets in b (n = 3 mice). d,e, Representative immunofluorescence (IF; d) and quantification (e) of Cas9 (red) and DAPI (blue) in brains of Chd3 +/+ + NT-TeABE, Chd3 hR1025W/+ + NT-TeABE and Chd3 hR1025W/+ + TeABE (n = 9 slices from 3 mice per group; 3 slices per mouse). f,g, Representative CHD3 staining (f) and quantification (g) in RSC and Hip (P < 0.0001, Chd3 +/+ + NT-TeABE versus Chd3 hR1025W/+ + NT-TeABE in RSC; P < 0.0001, Chd3 hR1025W/+ + NT-TeABE versus Chd3 hR1025W/+ + TeABE in RSC; two-way ANOVA with Šidák’s test; n = 9 slices from 3 mice per group). Scale bars, 500 μm (overview), 50 μm (S1Tr and CA1). hj, Representative immunoblots of CHD3 in whole brain (h), RSC (i) and Hip (j) lysates. k, Quantification of hj (P = 0.0033, Chd3 +/+ + NT-TeABE versus Chd3 hR1025W/+ + NT-TeABE in brain; P = 0.0435, Chd3 hR1025W/+ + NT-TeABE versus Chd3 hR1025W/+ + TeABE in brain; n = 5 mice; unpaired two-sided t-tests). See Supplementary Table 5 for complete P values for g and k. Data are the mean ± s.d. in g and k; *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. The schematic in a was created using BioRender (https://biorender.com).

Source Data

Extended Data Fig. 5. In vivo on-target base editing efficiency analysis through next-generation sequencing.

Extended Data Fig. 5

a, Immunoblotting of full-Cas9 and Cas9 N-terminal of expression levels under varying viral doses in mice. The quantitative analysis of TeABE expression level (b, P < 0.0001 (No TeABE or AAV-TeABE-N or AAV-TeABE-C vs AAV-TeABE-N + AAV-TeABE-C(High)), P < 0.0001 (No TeABE or AAV-TeABE-N or AAV-TeABE-C vs AAV-TeABE-N + AAV-TeABE-C(Low)), P < 0.0001 (AAV-TeABE-N + AAV-TeABE-C(High) vs AAV-TeABE-N + AAV-TeABE-C(Low)), n = 6 independent experiments, unpaired two-side t-test) and TeABE assembly efficiency (c, P < 0.0001 (No TeABE or AAV-TeABE-N or AAV-TeABE-C vs AAV-TeABE-N + AAV-TeABE-C(High)), P < 0.0001 (No TeABE or AAV-TeABE-N or AAV-TeABE-C vs AAV-TeABE-N + AAV-TeABE-C(Low)), P < 0.0001 (AAV-TeABE-N + AAV-TeABE-C(High) vs AAV-TeABE-N + AAV-TeABE-C(Low)), n = 6 independent experiments, unpaired two-side t-test) in a. d, Representative gel electrophoresis images of PCR products from the on-target sites in retrosplenial Cortex (RSC), hippocampus (Hip), anterior cingulate cortex (ACC), olfactory bulb (OB), prefrontal cortex (PFC), cerebellar cortex (CB) of Chd3 hR1025W/+ mice injected with TeABE and the brain of Chd3 hR1025W/+ mice injected with NT-TeABE. The shown result is representative of three independent repetitions, all yielding consistent findings. NGS results and bystander effect statistics from the brains of Chd3 hR1025W/+ mice injected with NT-TeABE (e), and with TeABE RSC (g), Hip (i), ACC (k), OB (m), PFC (o), CB (q). The numbers within the boxes in f, h, j, l, n, p, r represent the proportion of reads for that sequence relative to all reads in the left corresponding panel. “An” indicates that the A base at position “n” has undergone a change due to on-target or bystander effects. Bold letters represent substitutions. The green box indicates on-target editing, while the magenta box represents the bystander effect. Chd3 hR1025W/+ mice were subjected to next-generation sequencing at 4 weeks after AAV injection. Statistical values represent the mean ± S.D., ****P < 0.0001.

Source Data

To quantify in vivo editing rates, we performed targeted next-generation sequencing (NGS) across the RSC, hippocampus, ACC, olfactory bulb (OB), prefrontal cortex (PFC) and cerebellum (CB) from Chd3 hR1025W/+ mice treated with either a non-targeting TeABE (NT-TeABE) or the TeABE (Extended Data Fig. 5d). Robust on-target correction was detected in all regions, with A11 editing of around 10–15%, whereas bystander A13 editing remained low at about 2–3% (Fig. 3b; representative CRISPResso2 outputs shown in Extended Data Fig. 5e–r). We also classified allele outcomes and report the ratio of A11-only correction to A11 + A13 double-edited reads; correction-only alleles constituted ≥80% of edited molecules across regions (Fig. 3c). Because these measurements are derived from bulk tissue containing neurons and glia, and TeABE is driven by the neuron-selective hSyn promoter, the true neuronal editing rate is likely to be higher than the bulk estimates.

To further examine the potential off-target effects of in vivo base editing, we performed GUIDE-seq in the mouse Neuro-2a cell line and identified four candidate off-target loci (h CHD3, OT1–OT4; Supplementary Fig. 4a). We then carried out targeted amplicon sequencing across multiple brain regions from TeABE-treated mice alongside NT-TeABE-treated littermate controls. At hCHD3 OT1, editing was confined to the canonical A11 position in the expected deamination window, with low frequencies averaging around 0.6% and a maximal value of 0.645% in the hippocampus. The remaining three sites showed similar low activity, with all measured off-target rates <1% across various brain regions (Supplementary Fig. 4b–e). Given these uniformly low in vivo frequencies, which is in contrast to the robust on-target editing observed at the therapeutic locus, we conclude that off-target effects of TeABE is minimal.

Immunofluorescence staining of Cas9 confirmed efficient expression of the dual AAV-TeABE system in cortical regions, including the RSC, PtA, S1Tr and S1BF and the hippocampal areas CA1, CA2, CA3 and DG (Fig. 3d,e). Restoration of CHD3 levels in these brain regions was confirmed, consistent with the Cas9 expression levels (Fig. 3f,g). Immunoblot analyses of samples from WT mice injected with AAV-NT-TeABE and Chd3 hR1025W/+ mice treated with AAV-NT-TeABE or AAV-TeABE further demonstrated a significant increase in CHD3 levels after TeABE delivery (Fig. 3h–k). These findings confirm the effectiveness of AAV-PHP.eB-mediated Cas9 transduction and in vivo base editing for correcting Chd3 hR1025W in the mouse brain.

TeABE corrects behavioural defects in mice

To evaluate the therapeutic effects of TeABE treatment in Chd3 hR1025W/+ mice, we conducted a series of behavioural experiments (Extended Data Fig. 6a). Intellectual disability, a hallmark symptom of SNIBCPS, was assessed using the three-chamber novel object recognition test, whereas the Barnes maze test was used to measure cognitive and spatial learning abilities. In the novel object recognition test, treated mice exhibited a restored preference for novel objects and a significant increase in the recognition preference index, which was absent in untreated Chd3 hR1025W/+ mice (Fig. 4a–c and Extended Data Fig. 6b–d). Similarly, in the Barnes maze test, treated mice demonstrated a shorter latency to locate the target hole during test 1 on day 6 and test 2 on day 13, a result that reflected enhanced spatial learning and memory abilities following treatment (Fig. 4d–g).

Extended Data Fig. 6. Behavioral experiment in Chd3hR1025W/+ mice.

Extended Data Fig. 6

a, Schematic representation of mice behavioral experiments and sampling time points. b, The model and representative locomotion heatmaps in the three-chamber novel object recognition test of Chd3 +/+ (NT-TeABE), Chd3 hR1025W/+ (NT-TeABE) and Chd3 hR1025W/+ (TeABE) mice when only object 1 is placed. Quantification of time spent in sniffing (c, P = 0.0259 (Chd3 +/+ + NT-TeABE O1 vs E), P = 0.0431 (Chd3 hR1025W/+ + NT-TeABE O1 vs E), P = 0.0156 (Chd3 hR1025W/+ + TeABE O1 vs E), n = 7 mice, unpaired two-side t-test) and object cognition preference index (d) in b. e, The model and representative locomotion heatmaps in the three-chamber novel object recognition test of Chd3 +/+ (NT-TeABE), Chd3 hR1025W/+ (NT-TeABE) and Chd3 hR1025W/+ (TeABE) mice when only stranger 1 is placed. Quantification of time spent in sniffing (f, P = 0.0291 (Chd3 +/+ + NT-TeABE S1 vs E), P = 0.0229 (Chd3 hR1025W/+ + NT-TeABE S1 vs E), P = 0.0004 (Chd3 hR1025W/+ + TeABE S1 vs E), n = 7 mice, unpaired two-side t-test) and social approach preference index (g) in e (n = 7). h, Representative heat maps of Chd3 +/+ (NT-TeABE), Chd3 hR1025W/+ (NT-TeABE) and Chd3 hR1025W/+ (TeABE) mice in the elevated plus maze (open arm indicates top and bottom arms; closed arm indicates left and right arms). Quantification of time in open arm (i, P = 0.9182 (Chd3 +/+ + NT-TeABE vs Chd3 hR1025W/+ + NT-TeABE), P = 0.7728 (Chd3 +/+ + NT-TeABE vs Chd3 hR1025W/+ + TeABE), P = 0.8489 (Chd3 hR1025W/+ + NT-TeABE vs Chd3 hR1025W/+ + TeABE), n = 7 mice, One-way ANOVA + Tukey’s HSD) and entries to open arm (j) in h. k, Representative locomotion track traces of Chd3 +/+ (NT-TeABE), Chd3 hR1025W/+ (NT-TeABE) and Chd3 hR1025W/+ (TeABE) mice in the open field test. Quantitative analysis of overall distance traveled (l), distance travel in center (m), time spent in center (n) and entries into center (o) (n = 7 mice, One-way ANOVA + Tukey’s HSD). n represents the number of mice. Statistical values represent the mean ± S.D., *P < 0.05, ***P < 0.001. The schematics in a, b and e were created using BioRender (https://biorender.com).

Source Data

Fig. 4. TeABE rescues cognitive and autistic-like behaviours in Chd3hR1025W/+ mice.

Fig. 4

a, Schematic (top) and locomotion heatmaps (bottom) for the three-chamber novel object recognition test. b,c, Time spent sniffing O1 versus NO (b) and the preference index (c) (b, P < 0.0001 for Chd3 +/+ + NT-TeABE, P = 0.0044 for Chd3 hR1025W/+ + TeABE; c, P < 0.0001, P = 0.0078). d, Schematic of the Barnes maze experiment. eg, Latency to locate the target hole over training and probe trials (e) and in test 1 (f) and test 2 (g) (e, P = 0.039, Chd3 +/+ + NT-TeABE versus Chd3 hR1025W/+ + NT-TeABE, P = 0.048, Chd3 hR1025W/+ + NT-TeABE versus Chd3 hR1025W/+ + TeABE, two-way ANOVA with Tukey’s test; f, P < 0.0001 and P = 0.0006; g, P = 0.0011 and P = 0.0022). h, Top, schematic of the three-chamber social novelty experiment. Bottom, representative heatmaps. i,j, Time spent sniffing (i) and the social preference index (j) (i, P = 0.001 for Chd3 +/+ + NT-TeABE, P = 0.021 for Chd3 hR1025W/+ + TeABE; j, P = 0.0247 and P = 0.023). k, Schematic of the social intruder paradigm, which consisted of five trials (T1–T5). lq, Sniffing time at T1 (l) and the social novelty index (m; (T5 – T4)/(T5 + T4)), cumulative sniffing across trials (n) and per-trial cumulative sniffing for each indicated group (oq) (l, P = 0.0004 and P  = 0.0032; m, P = 0.0004 and P = 0.0002; for nq, see Supplementary Table 6 for P values; two-way ANOVA with Tukey’s test). r, Representative images from the marble-burying test. s, Number of buried marbles in 10 min (P = 0.0033 and P = 0.0268). t, Self-grooming duration over 30 min (P = 0.0109 and P = 0.0313; one-way ANOVA). P values in c, f, g, j, l, m, s and t compare Chd3 +/+ + NT-TeABE versus Chd3 hR1025W/+ + NT-TeABE, and Chd3 hR1025W/+ + NT-TeABE versus Chd3 hR1025W/+ + TeABE. n = 7 mice per group, unpaired two-sided t-tests (b,c,f,g,i,j,s). Data are the mean ± s.d.; *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. The schematics in a, d, h and k were created using BioRender (https://biorender.com).

Source Data

Autistic-like phenotypes, including social impairment and repetitive stereotyped behaviours, are common in SNIBCPS. To evaluate social competence, we used the three-chamber social interaction test and the social intruder test. In the three-chamber test, treated mice spent significantly more time sniffing a stranger compared with untreated Chd3 hR1025W/+ mice, with a concurrent increase in the social preference index, which indicated amelioration of social deficits (Fig. 4h–j and Extended Data Fig. 6e–g). Similar improvements were observed in the social intruder test, in which treated mice exhibited increased interaction times during both the T1 and T5–T4 trials, which reflected enhanced sociability and social novelty recognition (Fig. 4k–m). Untreated mutant mice lacked social familiarity and novelty processes (for example, changes in sniffing time), whereas these processes were restored in treated mice (Fig. 4n–q).

To assess repetitive stereotyped behaviours, we performed marble-burying and self-grooming experiments. Treated mice displayed a significant reduction in the number of buried marbles and self-grooming duration compared with untreated mice, thereby indicating improved stereotyped behaviours (Fig. 4r–t). Anxiety levels were examined using the elevated-plus maze and open-field tests. No significant differences were observed among the groups in terms of time spent in open arms, entries to open arms or exploratory activity (Extended Data Fig. 6h–o), which suggests that the hR1025W mutation does not affect anxiety. In summary, TeABE treatment effectively alleviated autistic-like behaviours, including social deficits and stereotyped behaviours, in Chd3 hR1025W/+ mice.

Hypotonia, a common symptom of SNIBCPS, is characterized by involuntary, sustained muscle contractions that result in abnormal posture and movement disorders, including gait abnormalities, altered stride and reduced grip strength in mice. In the tail suspension experiment, Chd3 hR1025W/+ mice were evaluated for limb tightness and scored for clasping and joint laxity (Extended Data Fig. 7a). Treated mice exhibited significantly lower scores than untreated mutant animals, which indicated a reduction in involuntary muscle contractions following treatment (Extended Data Fig. 7a–c). Gait analysis further assessed locomotor abnormalities associated with hypotonia. Treated mice demonstrated improvements, including a reduced hindlimb foot angle, decreased hindlimb spacing and increased stride length, with values approaching those of WT controls (Extended Data Fig. 7d–h). These results suggest that TeABE treatment enhanced locomotor coordination and normalized gait patterns.

Extended Data Fig. 7. Rescue of hypotonia in Chd3hR1025W/+ mice with TeABE editing in vivo.

Extended Data Fig. 7

a, Representative images showing the tail suspension test for Chd3 +/+ (NT-TeABE), Chd3 hR1025W/+ (NT-TeABE) and Chd3 hR1025W/+ (TeABE) mice. The blue arrow points to the limbs clasping. Quantitative anlysis of the clasping score (b, P < 0.0001 (Chd3 +/+ + NT-TeABE vs Chd3 hR1025W/+ + NT-TeABE), P = 0.0019 (Chd3 hR1025W/+ + NT-TeABE vs Chd3 hR1025W/+ + TeABE), n = 7 mice, unpaired two-side t-test) and joint laxity score (c, P < 0.0001 (Chd3 +/+ + NT-TeABE vs Chd3 hR1025W/+ + NT-TeABE), P < 0.0001 (Chd3 +/+ + NT-TeABE vs Chd3 hR1025W/+ + TeABE), P = 0.0826 (Chd3 hR1025W/+ + NT-TeABE vs Chd3 hR1025W/+ + TeABE), n = 7 mice, unpaired two-side t-test) in a. d, Representative images showing the gait analysis for Chd3 +/+ (NT-TeABE), Chd3 hR1025W/+ (NT-TeABE) and Chd3 hR1025W/+ (TeABE) mice. The Angle refers to the intersection of the extension lines of the middle finger of the hindlimb of the mouse (red angle). The hindlimb spacing refers to the distance between the center points of the two hind feet (blue line segment). Quantitative analysis of the hindlimb foot angle (e, P = 0.0002 (Chd3 +/+ + NT-TeABE vs Chd3 hR1025W/+ + NT-TeABE), P = 0.0013 (Chd3 hR1025W/+ + NT-TeABE vs Chd3 hR1025W/+ + TeABE), n = 7 mice, unpaired two-side t-test) and hindlimb spacing (f, P = 0.0314 (Chd3 +/+ + NT-TeABE vs Chd3 hR1025W/+ + NT-TeABE), P = 0.0375 (Chd3 hR1025W/+ + NT-TeABE vs Chd3 hR1025W/+ + TeABE), n = 7 mice, unpaired two-side t-test) in d. g, Representative images showing the stride analysis for Chd3 +/+ (NT-TeABE), Chd3 hR1025W/+ (NT-TeABE) and Chd3 hR1025W/+ (TeABE) mice. The distance between two adjacent blue markers on the same side is the stride (bule line segment). Blue ink marks the hindlimbs and red ink marks the forelimbs. h, Quantitative analysis of the stride in g (P < 0.0001 (Chd3 +/+ + NT-TeABE vs Chd3 hR1025W/+ + NT-TeABE), P = 0.0023 (Chd3 +/+ + NT-TeABE vs Chd3 hR1025W/+ + TeABE), P = 0.0004 (Chd3 hR1025W/+ + NT-TeABE vs Chd3 hR1025W/+ + TeABE), Chd3 +/+ + NT-TeABE: n = 24; Chd3 hR1025W/+ + NT-TeABE: n = 36; Chd3 hR1025W/+ + TeABE: n = 29 from 7 mice, unpaired two-side t-test). i, Representative images showing the rotarod test and for Chd3 +/+ (NT-TeABE), Chd3 hR1025W/+ (NT-TeABE) and Chd3 hR1025W/+ (TeABE) mice. Blue arrows point to fallen mice. Quantitative analysis of distance (j, P = 0.0016 (Chd3 +/+ + NT-TeABE vs Chd3 hR1025W/+ + NT-TeABE), P = 0.0382 (Chd3 +/+ + NT-TeABE vs Chd3 hR1025W/+ + TeABE), P = 0.0053 (Chd3 hR1025W/+ + NT-TeABE vs Chd3 hR1025W/+ + TeABE), n = 7 mice, unpaired two-side t-test), speed to fall (k, P = 0.0059 (Chd3 +/+ + NT-TeABE vs Chd3 hR1025W/+ + NT-TeABE), P = 0.004 (Chd3 hR1025W/+ + NT-TeABE vs Chd3 hR1025W/+ + TeABE), n = 7 mice, unpaired two-side t-test) and time to fall (l, P = 0.0035 (Chd3 +/+ + NT-TeABE vs Chd3 hR1025W/+ + NT-TeABE), P = 0.0457 (Chd3 hR1025W/+ + NT-TeABE vs Chd3 hR1025W/+ + TeABE), n = 7 mice, unpaired two-side t-test) in i. Statistical values represent the mean ± S.D. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Source Data

Grip strength was evaluated using the rotarod test, which measures the ability of mice to maintain their grip on a rotating rod as the speed increases. Untreated Chd3 hR1025W/+ mice fell at lower speeds, whereas treated mice remained on the rod for longer durations, covered greater distances and endured higher rotational speeds, which reflected significantly improved grip strength (Extended Data Fig. 7i–l and Supplementary Video 1). Collectively, these findings demonstrate that TeABE treatment effectively alleviates hypotonia-related phenotypes in Chd3 hR1025W/+ mice.

TeABE restores abnormal neural development

Next, we asked whether TeABE can ameliorate neurodevelopmental abnormalities caused by the Chd3 hR1025W/+ allele and first assessed gross neuroanatomy. We quantified the ratio of brain width to length and cortical thickness by Nissl staining and immunofluorescence in age-matched and sex-matched cohorts: WT + NT-TeABE; Chd3 hR1025W/+ + NT-TeABE; and Chd3 hR1025W/+ + TeABE. Across groups, neither the ratio nor regional cortical thickness were significantly different, which indicated that our model does not exhibit overt macrocephaly and that TeABE treatment does not alter brain size (Extended Data Fig. 8a–e). We therefore focused subsequent analyses on cellular and molecular phenotypes.

Extended Data Fig. 8. Effects of TeABE on the brain structure and cortical layers of Chd3hR1025W/+ mice.

Extended Data Fig. 8

a, Top-down overview of the overall brain structure in Chd3 +/+ (NT-TeABE), Chd3 hR1025W/+ (NT-TeABE) and Chd3 hR1025W/+ (TeABE) mice. b, Statistical analysis of the width/length ratio of the mouse brain in a. c, Representative Nissl-stained images of brain sections from Chd3 +/+ (NT-TeABE), Chd3 hR1025W/+ (NT-TeABE) and Chd3 hR1025W/+ (TeABE) mice. Statistical analysis of thickness of dorsal cortex (d) and lateral cortex (e) in Chd3 +/+ (NT-TeABE), Chd3 hR1025W/+ (NT-TeABE) and Chd3 hR1025W/+ (TeABE) mice. n represents biological replicates. Representative staining images and statistical analysis of TBR1 (f), CTIP2 (g, P = 0.0043 (II/III Chd3 +/+ + NT-TeABE vs Chd3 hR1025W/+ + NT-TeABE), P = 0.0019 (II/III Chd3 hR1025W/+ + NT-TeABE vs Chd3 hR1025W/+ + TeABE), P = 0.0291 (VI Chd3 +/+ + NT-TeABE vs Chd3 hR1025W/+ + NT-TeABE), P = 0.0137 (VI Chd3 hR1025W/+ + NT-TeABE vs Chd3 hR1025W/+ + TeABE), n = 6 slices from 3 mice, unpaired two-side t-test), SATB2 (h), and CUX1 (i) expression in S1Tr in Chd3 +/+ (NT-TeABE), Chd3 hR1025W/+ (NT-TeABE) and Chd3 hR1025W/+ (TeABE) mice. Statistical values represent the mean ± S.D., *P < 0.05, **P < 0.01.

Source Data

We next assessed cortical lamination and hippocampal cellular phenotypes. Immunofluorescence for layer markers—TBR1 (layer VI), CTIP2 (also known as BCL11B) (layer V), SATB2 (layers II–IV) and CUX1 (layers II/III)—revealed no significant differences in the distribution or density of TBR1-positive, SATB2-postive or CUX1-positive cells between WT + NT-TeABE and Chd3 hR1025W/+ + NT-TeABE cohorts. By contrast, CTIP2 showed a modest but significant alteration (Extended Data Fig. 8f–i), which indicated that overall cortical laminar organization is largely preserved in Chd3 hR1025W/+ mice. However, the hippocampal CA3 region displayed clear cellular changes, whereby SOX2 and KI67 signals were increased, and doublecortin (DCX) was elevated, a result consistent with enhanced progenitor proliferation and an expanded immature neuronal population. Conversely, TBR1 was reduced and parvalbumin interneuron staining was decreased, a finding indicative of impaired maturation (Supplementary Fig. 5a–e). Notably, after delivery of AAV-TeABE at 6–7 weeks of age, these CA3 abnormalities were partially to fully normalized towards WT levels. This result provides support that restoration of CHD3 through base editing mitigates cellular deficits (Supplementary Fig. 5a–e).

To analyse molecular mechanisms, we first performed bulk RNA sequencing (RNA-seq) on age-matched WT + NT-TeABE, Chd3 hR1025W/+ + NT-TeABE and Chd3 hR1025W/+ + TeABE cohorts (Extended Data Fig. 9a). The Chd3 hR1025W/+ allele was associated with a widespread downregulation of neurodevelopment-related genes (Extended Data Fig. 9b–d), whereas TeABE treatment increased the expression of these dysregulated transcripts towards WT levels (Extended Data Fig. 9e–g). Given that CHD3 is a chromodomain helicase remodeller, we proposed that altered chromatin accessibility underlies these transcriptional changes. Accordingly, we performed ATAC–seq on brain tissue from the same groups and observed a focal loss of accessibility at the distal X chromosome spanning Sts, Nlgn4l, Akap17a and Asmt in the brains of Chd3 hR1025W/+ mice (Extended Data Fig. 9h). These loci have been implicated in learning and memory (Sts)39, autism-relevant behaviours (Nlgn4l)40, grip strength (Akap17a)41 and neurobehavioural adaptation to exercise (Asmt)42, results that align with SNIBCPS features.

Extended Data Fig. 9. Effect of TeABE on the gene expression profiles and ATAC analysis of Chd3hR1025W/+ mice.

Extended Data Fig. 9

a, Heatmap of scaled expression values from RNA-seq analysis showing gene expression patterns in Chd3 +/+ (NT-TeABE), Chd3 hR1025W/+ (NT-TeABE) and Chd3 hR1025W/+ (TeABE) mice. Volcano plots of differential gene expression from RNA-seq comparing Chd3 hR1025W/+ (NT-TeABE) mice versus Chd3 +/+ (NT-TeABE) mice (b) and Chd3 hR1025W/+ (TeABE) mice versus Chd3 hR1025W/+ (NT-TeABE) mice (e) by DESeq2. A two-sided test was applied with the Benjamini-Hochberg method for multiple comparisons. KEGG pathway enrichment analysis of differentially expressed genes from RNA-seq, comparing Chd3 hR1025W/+ (NT-TeABE) mice versus Chd3 +/+ (NT-TeABE) (downregulated) (c) and Chd3 hR1025W/+ (TeABE) mice versus Chd3 hR1025W/+ (NT-TeABE) (upregulated) (f). d, g, Gene Set Enrichment Analysis (GSEA) plots showing enrichment scores for the neuroactive ligand-receptor interaction gene set in c and f. A one-sided test was used, and FDR adjustment was performed for multiple comparisons (d, Padj=1.243 × 10−8; g, Padj=3.73 × 10−8). h, ATAC-seq signal profiles showing chromatin accessibility changes at the Sts, Nlgn4l, Akap17a, and Asmt gene loci on the X chromosome. The expression profiles of Sts (i, P = 0.0021 (Chd3 +/+ + NT-TeABE vs Chd3 hR1025W/+ + NT-TeABE), P = 0.0038 (Chd3 hR1025W/+ + NT-TeABE vs Chd3 hR1025W/+ + TeABE), n = 6 independent experiments from 3 mice, unpaired two-side t-test), Nlgn4l (j, P = 0.017 (Chd3 +/+ + NT-TeABE vs Chd3 hR1025W/+ + NT-TeABE), P = 0.0198 (Chd3 hR1025W/+ + NT-TeABE vs Chd3 hR1025W/+ + TeABE), n = 6 independent experiments from 3 mice, unpaired two-side t-test), Akap17a (k, P = 0.0009 (Chd3 +/+ + NT-TeABE vs Chd3 hR1025W/+ + NT-TeABE), P = 0.0127 (Chd3 hR1025W/+ + NT-TeABE vs Chd3 hR1025W/+ + TeABE), n = 6 independent experiments from 3 mice, unpaired two-side t-test), and Asmt (l, P = 0.0051 (Chd3 +/+ + NT-TeABE vs Chd3 hR1025W/+ + NT-TeABE), P = 0.0029 (Chd3 hR1025W/+ + NT-TeABE vs Chd3 hR1025W/+ + TeABE), n = 6 independent experiments from 3 mice, unpaired two-side t-test) by RNA-seq analysis. m, Schematic representation of the mechanism by which CHD3 mutations influence chromatin accessibility and related gene expression, leading to SNIBCPS symptoms. Statistical values represent the mean ± S.D., *P < 0.05, **P < 0.01, ***P < 0.001. The schematic in m was created using BioRender (https://biorender.com).

Source Data

Consistent with impaired CHD3 remodelling, the RNA-seq data showed concordant downregulation of these genes in mutants, whereas TeABE restored both accessibility (ATAC–seq) and transcript abundance (RNA-seq) towards WT levels (Extended Data Fig. 9i–l), paralleling behavioural rescue. Together, these data support a model in which R1025W reduces CHD3 protein levels, which leads to locus-specific chromatin closing and mis-expression of neurodevelopmental genes that contribute to SNIBCPS-like phenotypes, and base editing reverses these molecular defects (Extended Data Fig. 9m).

Efficient TeABE reconstitution in the primate brain

To assess translational feasibility, we evaluated delivery and intein-mediated reconstitution of TeABE in NHPs. Dual AAV9 vectors encoding split-TeABE were intrathecally administered to promote broad CNS exposure (Fig. 5a). Immunoblotting of regional brain lysates with anti-Cas9 antibody revealed robust editor expression and efficient reconstitution of the full-length complex (around 180 kDa), with reconstitution efficiencies of about 70% across the frontal cortex, occipital cortex and cerebellum (Fig. 5b–d). Immunofluorescence confirmed widespread parenchymal transduction, with Cas9 signals detected throughout the cortex and cerebellum and >30% neuronal transduction (Fig. 5e–g). These data confirm efficient AAV delivery and reconstitution of TeABE in the NHP brain, thereby supporting the clinical applicability of this approach.

Fig. 5. Efficient TeABE reconstitution and neuronal transduction in the NHP brain.

Fig. 5

a, Schematic of dual AAV9 split-TeABE delivery via intrathecal injection; aa, amino acids. b,c, Immunoblot (b) and quantification (c) of full-length Cas9 (around 180 kDa) and a N-terminal Cas9 fragment (anti-Cas9 polyclonal) in lysates of grey matter of the frontal lobe, occipital lobe and cerebellum from untreated monkeys and monkeys receiving low-dose or high-dose AAV9-TeABE (P < 0.0001 (frontal lobe, untreated versus high dose), P < 0.0001 (frontal lobe, untreated versus low dose), P = 0.0002 (frontal lobe, high dose versus low dose)). d, Split-TeABE assembly efficiency (full-length Cas9/(full-length Cas9 + N-terminal fragment); full/full+N-terminal) in different brain regions (P < 0.0001 (frontal lobe, untreated versus high dose), P < 0.0001 (frontal lobe, untreated versus low dose), P = 0.0011 (frontal lobe, high dose versus low dose)). See Supplementary Table 5 for complete P values for c and d; n indicates biologically independent samples; untreated, 2 monkeys; high dose, 1 monkey; low dose, 1 monkey; 3 samples from each untreated monkey, 6 samples from high dose or low dose monkey. e, Representative immunofluorescence images of Cas9 (red), NeuN (green) and DAPI (blue) in frontal, occipital and cerebellar cortex from high-dose AAV9-TeABE–treated monkeys. Scale bar, 1,000 μm. f, Higher-magnification views of boxed regions in e. Scale bar, 100 μm. g, Neuronal transduction rate of Cas9 (fraction of NeuN+ cells that are Cas9+) in frontal lobe, occipital lobe and cerebellum (P < 0.0001 for each region, untreated versus AAV-TeABE; untreated, n = 4 slices from 2 monkeys; AAV9-TeABE, n = 10 slices from the high-dose monkey). High dose, 1.20 × 1014 vg per split-TeABE vector; low dose, 3.00 × 1013 vg per vector. Unpaired two-sided t-tests (c,d,g). Data are the mean ± s.d.; *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. The schematic in a was created using BioRender (https://biorender.com).

Source Data

To test whether the reconstituted TeABE catalyses base editing in the NHP brain, we performed targeted amplicon NGS on macaque brain regions following AAV-mediated delivery of the split editor (Extended Data Fig. 10a,b). Although the primary guide (sgRNA-A11, Extended Data Fig. 4f) was designed against the human CHD3 sequence and carries four mismatches at the orthologous macaque site, we nonetheless detected bystander A-to-G conversions in the expected editing window—specifically at A13 and A16—in TeABE-treated samples but not in uninjected controls (Extended Data Fig. 10c–f), which indicated in vivo base-editing activity at the target locus. To further assess base-editing activity in the monkey brain, we analysed potential off-target sites in the monkey genome and identified a genomic locus with only two mismatches to sgRNA-A11 (Supplementary Table 4). Deep sequencing revealed measurable A-to-G editing at A11 and A13 in this putative off-target site in TeABE-treated tissue, which was absent in uninjected controls (Extended Data Fig. 10g–j). This result demonstrates that full-length TeABE is reconstituted and catalytically active in the NHP brain.

Extended Data Fig. 10. Validation of TeABE editing and assessment of bystander effects in non-human primates.

Extended Data Fig. 10

a, Schematic representation of the process for extracting genomic DNA and amplification using a nested PCR workflow. b, Representative gel electrophoresis images of PCR products from the CHD3-R1025 locus. The shown result is representative of three independent repetitions, all yielding consistent findings. NGS results (c) and heat map (d) of bystander effect statistics from the monkey without injection. NGS results (e) and heat map (f) of bystander effect statistics from monkeys injected with AAV9-TeABE (high dose). The numbers within the boxes in d,f represent the proportion of reads for that sequence relative to all reads. “An” indicates that the A base at position “n” has undergone a change due to bystander effects. NGS results (g) and heat map (h) of off-target effect statistics from the monkey without injection. NGS results (i) and heat map (j) of off-target effect statistics from the monkey injected with AAV9-TeABE (high dose). The numbers within the boxes in h,j represent the proportion of reads for that sequence relative to all reads. “An” indicates that the A base at position “n” has undergone a change due to off-target effects. The schematic in a was created using BioRender (https://biorender.com).

Source Data

These results provide compelling evidence for the efficacy of TeABE in the NHP brain, paving the way for the application of TeABE in clinical trials. This study represents a substantial advancement in gene therapy for brain disorders and highlights the transformative potential of base editing in treating genetic neurodevelopmental disorders.

Discussion

SNIBCPS is a rare autosomal genetic disorder characterized by language and intellectual development impairments, along with other symptoms1,6. This condition imposes a heavy burden on affected children and their families. Despite the severity of the disorder, no effective treatment for SNIBCPS has been reported. The primary association of SNIBCPS with specific mutations in CHD3 highlights gene therapy as a promising therapeutic strategy1,2. In this study, we developed and applied a base editor to repair the c.C3073T point mutation and assessed its therapeutic potential in Chd3 hR1025W/+ mice. Behavioural experiments demonstrated notable improvements in key symptoms, including cognitive deficits, spatial learning and memory impairments, autistic-like behaviours and hypotonia, which all underscore the efficacy of our approach.

Our investigation into the pathogenic mechanism of the Chd3 hR1025W mutation revealed that it accelerates the degradation of CHD3, which leads to reduced protein levels and associated neuronal abnormalities. Although our findings provide insights into the molecular impact of this mutation, further mechanistic studies are necessary to elucidate how the mutation affects the chromatin-remodelling functions of CHD3 and contributes to disease pathology. By using base editing, we successfully corrected the SNV and restored CHD3 protein levels in vivo. These results emphasize the potential of base editing as a precise therapeutic strategy for addressing genetic defects and mitigating disease symptoms.

Compared with the CRISPR–Cas9 system, base editing offers a safer alternative as it avoids inducing double-strand DNA breaks2426. Base editing has already demonstrated success in clinical trials for repairing genetic defects in various organs27,28,32,43. However, applying this technology to the CNS, particularly the brain, poses distinct challenges owing to its complexity and the risks associated with intervention44. Although base editing has shown promise in NHP models for non-CNS applications45,46, its use in the CNS has been limited to mouse models. These models are valuable for evaluating phenotype improvements but fall short of providing guidance on clinical dosing or application in humans. Bridging the gap between preclinical research and clinical translation remains a significant challenge.

Because the current base editor payload exceeds the packaging capacity of a single AAV, we used a dual-AAV, split-intein strategy to reconstitute TeABE in situ. Although effective, incomplete reconstitution limits maximal potency. That is, in NHPs, we measured around 70–80% full-length editor among the total Cas9 signal, which indicated that a fraction remains unreconstituted. Further improving delivery is therefore a priority. One route is single-vector packaging, which is enabled by more compact components—for example, smaller Cas orthologues and minimized editor architectures, which would obviate split reconstitution. In parallel, non-viral approaches are gaining momentum; for example, recent clinical reports of lipid-nanoparticle-delivered base editing have demonstrated in vivo feasibility47. Developing CNS-tropic lipid nanoparticles or alternative vehicles capable of efficient blood–brain barrier transit (or refined intrathecal formulations) is an important direction, alongside continued capsid engineering and dosing or promoter optimization. Collectively, these advancements should enhance on-target editing while reducing vector load, moving this strategy closer to clinical translation.

In conclusion, we demonstrated that in vivo base editing of CHD3 corrects a pathogenic allele, restores protein dosage and ameliorates molecular and behavioural deficits in a humanized mouse model, with efficient editor reconstitution and activity in the NHP brain following intrathecal AAV delivery. Future work will be required to determine whether base-editing strategies can also achieve durable anatomical correction in SNIBCPS and related neurodevelopmental disorders. These findings provide a proof of concept for treating SNIBCPS and, more broadly, dominant neurodevelopmental disorders. Our results also highlight priorities for optimization, including further reducing bystander and off-target edits, enabling single-vector CNS delivery and defining therapeutic windows and durability. With continued refinement of editor architectures and brain-targeted delivery systems, base editing is well positioned to advance towards clinical translation for disorders of the CNS.

Methods

Genetically modified mice

All experimental protocols and animal care and handling were approved by the Ethics Committee of Xinhua Hospital Affiliated to Shanghai Jiao Tong University School of Medicine (XHEC-F-2024-086). The bicistronic expression vector px330-Cas9 (Addgene, 42230) containing the Cas9 coding region and the sg sequence (5′-ACATATGCTTCGGAGACTCA-3′) was directly used for microinjection. A 134 bp oligonucleotide acted as the donor ssDNA for intracytoplasmic DNA microinjection (134 bp oligonucleotide sequence, with the edited bases indicated in bold: 5′-GAGTTTGCCGACATAT CCAAAGAGGACCAGATTAAGAAA CTGCATGATTTGCTGGGGCCACACATGCTGTGGAGACTCAAGGCAGATGTCTTTAAGAACATGCCAGCCAAGACCGA GCTCATTGTTCGAGTGGA-3′). For zygote intracytoplasmic DNA microinjection, the mixture of px330-Cas9-sg plasmid (50 ng μl–1) and 134 bp ssDNA donor (100 ng μl–1) was diluted in RNAase-free water.

All mice were bred and maintained according to Shanghai Laboratory Animal Center Institutional Animal Regulations. Mice were housed in a specific pathogen-free animal facility at the Center for Excellence in Molecular Cell Science (CEMCS) with autoclaved food, bedding and water. Animals were maintained at room temperature (20–25 °C) at a humidity of 30–70% on a 12/12-h light–dark cycle (7:00–19:00). All mouse studies were carried out following the guidelines of the Institutional Animal Care and Use Committee (IACUC) at the CEMCS. B6D2F1 mice (female C57BL/6J × male DBA/2) aged 6–8 weeks were used for zygote collection. ICR mice, purchased from Beijing Vital River Laboratory Animal Technology, were used for pseudo-pregnant foster mother and vasectomized males. Mice were generated through standard mouse breeding procedures in the CEMCS animal facility The Chd3 emh34 (endonuclease-mediated mutation-human 34 bp) mouse line was generated through homologous recombination using CRISPR–Cas9 technology. For the Chd3 emh34 mouse line, a 34 bp mouse sequence (5′-ACTGGGGCCACATATGCTTCGGAGACTCAAGGCG-3′) was exchanged for the human sequence (5′-GCTGGGGCCACACATGCTGTGGAGACTCAAGGCA-3′); edited bases are highlighted in bold.

B6D2F1 female mice (8 weeks old) were injected with 7 IU (international units) of pregnant mare’s serum gonadotropin (PMSG). Subsequently, 7 IU of human chorionic gonadotropin (hCG) was injected over 46-48 h. Female mice were housed with B6D2F1 male mice overnight. Zygotes were collected from oviducts of B6D2F1 females 24 h after hCG injection using hyaluronidase (Sigma, H3884). The px330-Cas9-sg plasmid and 134 bp ssDNA donor was thoroughly mixed before injection. Using a micromanipulator (Olympus) and a FemtoJet microinjector (Eppendorf), the injection mixture was injected into zygotes. The injected zygotes were cultured in AA-KSOM (Millipore, MR-106-D) medium for 24 h in an incubator at 37 °C with 5% CO2 until they developed into two-cell embryos.

The pseudo-pregnant foster mothers were prepared by mating oestrous ICR female mice with vasectomized male mice on the same day as the injection. The two-cell embryos were transferred into oviducts of 0.5 days post coitum (d.p.c.) recipient. Recipient mothers delivered pups at 19.5 d.p.c.

The neonatal mouse tissues were lysed with lysis buffer (100 mM Tris HCl (pH 7.8), 0.2% SDS, 5 mM EDTA, 200 mM NaCl and 100 μg ml–1 proteinase K) at 55 °C for more than 6 h, and then the mixture was boiled at 95 °C for 10 min to deactivate proteinase K. All mice were genotyped with specific primers (primer-F: 5′-TTAGCAACTTGGAGGGCTTC-3′; primer-R: 5′-TCTGCATGGGGCCTAGCTCC-3′). The Chd3 R1025W mutation was verified by Sanger sequencing. The primer sequences used for mouse construction and genotyping are listed in Supplementary Table 7.

Primary mouse cortical neuron culture

Mouse cortical neurons were extracted from 14.5-day-old embryos of either sex. Cerebral cortices were dissected and digested with 20 U ml–1 papain (LS003126, Worthington) at 37 °C for 30 min, then cultured at 100,000 cells per cm2 on Lab-Tek II chamber slides (154941, Thermo Fisher Scientific) in 0.5 ml per well of Neurobasal medium (21103-049, Gibco) supplemented with 0.2% B27 (17504-044, Gibco) and 2 mM GlutaMAX (35050-061, Gibco). Lipid transfection using Lipofectamine 2000 (11668-019, Invitrogen) with 0.2 μg of each vector was performed after 24 h of cultivation following the manufacturer’s protocol. The medium was changed every 2 days. For morphological analyses, neurons were immunofluorescently stained at day 3 in vitro to assess axonal morphology and at day 7 in vitro to evaluate dendritic morphology. Confocal microscopy was used to acquire images, and the total axonal length, axonal neurite length, dendritic branch numbers and dendritic branch length were quantified using the Simple Neurite Tracer plugin in ImageJ. The mouse Chd3 shRNA sequence is presented in Supplementary Table 8.

HEK293T cell culture and preparation of protein samples

HEK293T cells were cultured to approximately 90% confluency in a culture dish (Corning) with DMEM (11965092, Gibco) and 10% FBS. Cells were transfected with the corresponding expression plasmids using Lipofectamine 2000 (11668-019, Invitrogen) according to the manufacturer’s instructions. After 72 h of incubation, the cells were washed with 1× PBS, collected via gentle pipetting and lysed in loading buffer. The lysates were heated at 100 °C for at least 30 min to ensure complete protein denaturation and stored at −20 °C. Proteins from cultured neuronal cells were extracted using the same protocol as for HEK293T cells.

RNA extraction and reverse transcription

Total RNA was extracted from cultured mouse cortical neurons or HEK293T cells using TRIzol reagent (15596018, Invitrogen) following the manufacturer’s instructions. Reverse transcription was performed with PrimeScript RT master mix (RR036A, Takara Bio) according to the provided protocol, using 500–1,000 ng total RNA as the template for each PCR reaction.

qPCR

qPCR was performed to measure the relative mRNA expression of Chd3, normalized to Gapdh. The experiments were conducted using SYBR Green PCR Premix (QPK-201, TOYOBO), and data were analysed on a StepOnePlus Real-Time PCR system (Applied Biosystems). The qPCR program included an initial denaturation at 95 °C for 10 min, followed by 40 cycles of amplification at 95 °C for 10 s, 60 °C for 15 s and 72 °C for 20 s. Relative mRNA levels of Chd3 were calculated and normalized using the ΔCT method, with Gapdh serving as the internal control. The primers used are listed in Supplementary Table 9.

Immunoblotting

Protein samples from mouse tissues were lysed using radioimmunoprecipitation assay (RIPA) buffer containing 150 mM NaCl, 1% sodium deoxycholate, 0.1% SDS, 50 mM Tris-HCl (pH 7.4), 1% Triton X-100 and protease inhibitor cocktail tablets (04693159001, Roche). The tissue samples were thoroughly digested on a rotating shaker at 4 °C, and the lysates were centrifuged at 10,000g for 10 min at 4 °C. The resulting supernatant was collected as the protein sample and heated at 100 °C for at least 30 min to ensure complete denaturation. The samples were then subjected to gel electrophoresis using SDS–polyacrylamide gels (Precast gel Tris-Gly 4–20%, 10 wells, 1.5 mm, GSG2001-420T) at a constant voltage of 80 V for stacking and 120 V for separation. Proteins were transferred onto polyvinylidene fluoride membranes (pore size of 0.45 μm, Merck Millipore) at a constant current of 200 mA. Membranes were blocked with 5% bovine serum albumin (BSA) diluted in 1× Tris-buffered saline (TBS)-Tween 20 for 2 h at room temperature, followed by overnight incubation at 4 °C with primary antibodies. After washing with 1× TBS-Tween 20, membranes were incubated with secondary antibodies for 1 h at room temperature. Protein bands were visualized using chemiluminescence (ECL ImmunoBlotting Substrate, 32106, Pierce). Raw images of the immunoblots are shown in Supplementary Fig. 1.

AAV plasmid construction and production

The plasmid vectors related to AAV virus packaging were constructed as previously reported29. In brief, we generated the AAV vector through golden gate assembly and restriction enzyme digestion, the first part of which contains the human U6 promoter to initiate the expression of sgRNA and the human synapsin promoter to express split spCas9 protein (amino acids 1–1029) conjugated to the intein-N element. The second part of the AAV vector includes the human synapsin promoter to trigger the expression of split spCas9 protein (amino acids 1030–1368), in which the TadA*(LOF)-TadA*(F148A) segment is embedded at the 1249 site and replaces the amino acid 1249–1263 segment of spCas9. Note that the WPRE3 element was integrated upstream of the poly(A) tail to enhance the expression and translation of the entire cassette. Cloning of the plasmids was done individually and confirmed by Sanger sequencing or whole plasmid sequencing. The gRNA design was completed using the online platform https://www.benchling.com. The packaging of AAV viruses and titration were performed by PackGene Bioscience.

FACS

First, we perfused each mouse with 1× PBS and isolated brain cortex tissue. The tissue was treated using a neural tissue dissociation kit (Miltenyi Biotechnology) to fully lyse the cells and to isolate single cells. Then, we used a BD Fusion FACS flow cytometer (BD) to sort and collect the single cells. Note that for each sorting and collection experiment, we maintained consistent parameters, such as voltage. We also used the 488–513 nm fluorescence channel to sort GFP-positive cells and collected single cells with fluorescence intensity above log103.

Nested PCR

gDNA was extracted from tissue samples using a standard phenol–chloroform method, followed by quantification with a NanoDrop spectrophotometer. The initial PCR amplification was performed using outer primers designed to flank the target region, with a reaction mixture containing 50 ng gDNA, 0.5 μM each of outer primer, 10 μl of 2× Ex Taq polymerase mix and 7 μl nuclease-free water in a total volume of 20 μl. Thermal cycling conditions included an initial denaturation at 95 °C for 5 min, followed by 20 cycles of 95 °C for 30 s, 60 °C for 30 s and 72 °C for 1 min, with a final extension at 72 °C for 10 min. For the nested PCR, the first-round PCR product was diluted to 1/1,000 of its original concentration as the template, using inner primers specific to the target sequence. Cycling conditions were identical to the initial PCR. Amplified products were analysed by agarose gel electrophoresis stained with ethidium bromide, and bands were visualized under UV light for subsequent sequencing. Raw gel images of the PCR products are shown in Extended Data Fig. 6d and in Supplementary Fig. 1.

Analysis of on-target editing efficacy and bystander effect in cells

In brief, for the in vitro single-base editing efficiency and bystander effect analysis, we used the EditR online analysis tool (https://moriaritylab.shinyapps.io/editr_v10/) to analyse and quantify the Sanger sequencing chromatograms48. For the in vivo base-editing efficiency analysis, we first extracted gDNA from the single cells sorted by flow cytometry. Then, we constructed the NGS library using different index sequences. The library samples were sent to Shanghai JMDNA Biology. After obtaining the sequencing data, we used CRISPResso2 to analyse and quantify the results with support from the Medical Science Data Center of Fudan University.

GUIDE-seq

GUIDE-seq experiments were performed in human HEK293T and mouse Neuro-2a cells following established protocols49 with minor modifications. In brief, 3 × 105 HEK293T or Neuro-2a cells were electroporated with Cas9–sgRNA ribonucleoprotein (RNP) complexes—comprising 5 µg WT Streptococcus pyogenes Cas9 protein and 2 µg CHD3-targeting sgRNA (5′-TTGAGTCTCCACAGCATGTG-3′)—together with 1.5 µg annealed double-stranded oligodeoxynucleotide (dsODN). Electroporation was performed using a Lonza 4D-Nucleofector system (Program DG-130). After 48–72 h, cells were collected and gDNA was extracted using a TIANamp Genomic DNA kit (Tiangen) for GUIDE-seq analysis (Azenta Life Sciences) using a previously described computational pipeline49. Because the engineered CHD3(R1025W/R1025W) cell line displayed markedly reduced viability following electroporation, WT HEK293T cells were used for GUIDE-seq. The specific off-target sites identified by GUIDE-seq in HEK293T cells are listed in Supplementary Table 10. HEK293T and Neuro-2a cells were obtained from the Cell Bank of the Chinese Academy of Sciences. Regular short tandem repeat (STR) profiling for cell line authentication and mycoplasma testing were performed by the Cell Bank of the Chinese Academy of Sciences. 

sgRNA sequences

Sequences of the sgRNAs C10, C11, A4, A10, A11, A13 and A15 (Extended Data Fig. 4) are provided in Supplementary Table 11.

R-loop assay

HEK293T cells were plated, cultured and transfected in a 24-well plate with 500 ng each of dSaCas9–sgRNA plasmid carrying a mCherry cassette and the tested ABE plasmid carrying a GFP cassette. After culturing for another 72 h, GFP–mCherry double-positive cells were sorted (BD FACSAriaFusion flow cytometer) and lysed using DirectPCR reagent (Viagene Biotech). Targeted PCR was performed using LA Taq (Takara) for high-throughput sequencing (Decode Biomedicine Technology).

Analysis of on-target editing efficacy, bystander effects and off-target effects in mice and monkeys

In mice, off-target sites were determined using GUIDE-seq. Primers used are provided in Supplementary Fig. 4 and Supplementary Table 12. The list of all identified genomic sites with read counts before and after filtering and consolidation are provided in Supplementary Table 13.

In monkeys, off-target sites were predicted using the Benchling CRISPR design tool, with the top ten predicted off-target sites listed in Supplementary Table 4. gDNA from brain tissues was extracted, and nested PCR was performed to amplify regions containing on-target sites and potential off-target sites. The primers used are detailed in Supplementary Table 14. Amplified products were submitted to Suzhou Hongxun Biotechnologies for NGS. Sequencing libraries were quantified and sequenced on an Illumina NextSeq 500/550 High Output Kit v.2.5 (75 cycles).

Immunohistochemistry

For immunofluorescence staining of cultured primary neurons, the cell medium was discarded and cells were washed with 1× PBS. Next, 4% paraformaldehyde (PFA) diluted with 1× PBS was used to fix cells for 20 min at room temperature. Following fixation, cells were washed with 1× PBS and blocked in a solution containing 5% BSA and 0.4% Triton X-100 in 1× PBS for 2 h at room temperature. Following fixation, cells were washed with 1× PBS and blocked in a solution containing 5% BSA and 0.4% Triton X-100 in 1× PBS for 2 h at room temperature. Data analyses of Extended Data Fig. 1m were collected and presented in Supplementary Table 15.

For immunofluorescence staining of Cas9 in mice, 0.8% Triton X-100 was used. Cells were incubated with primary antibodies prepared in the same blocking solution overnight at 4 °C, followed by secondary antibody incubation for 3 h at room temperature. For brain tissue preparation, mice were transcardially perfused with 1× PBS, followed by 4% PFA. Brains were post-fixed in 4% PFA overnight and dehydrated in 30% sucrose in 1× PBS. Dehydrated brains were sectioned into 40-μm slices using a Leica CM1950 cryostat. Sections were washed with 1× PBS, blocked with 5% BSA and 0.4% Triton X-100 in 1× PBS for 2 h at room temperature and incubated with primary antibodies overnight at 4 °C. Secondary antibody incubation was performed for 1 h at room temperature. Images were acquired using an Olympus VS200 high-throughput fluorescence microscope or an Olympus FV3000 confocal fluorescence microscope.

Nissl staining

Brains were collected from mice following euthanasia and fixed in 4% PFA overnight at 4 °C. After fixation, tissues were dehydrated through a graded ethanol series (70%, 95% and 100%) and embedded in paraffin. Coronal sections were cut at a thickness of 5 μm using a microtome and mounted onto glass slides. Deparaffinization was performed by immersing slides in xylene, followed by rehydration through descending ethanol concentrations and a final rinse in distilled water. Sections were then stained with 0.1% cresyl violet solution for 10 min at room temperature, followed by differentiation in 95% ethanol until the desired contrast was achieved. Slides were dehydrated again through ascending ethanol series, cleared in xylene and coverslipped with a mounting medium. Images were acquired using an Olympus VS200 high-throughput fluorescence microscope.

Antibodies

The primary antibodies used in this study and their dilutions are as follows: rabbit anti-CHD3 (1:1,000 dilution, ab109195, Abcam); rabbit anti-GAPDH (1:3,000 dilution, D264398, Sangon Biotech); rabbit anti-CRISPR–Cas9 (1:500 dilution, ab204448, Abcam); chicken anti-NeuN (1:1,000 dilution, ABN91, Millipore); rabbit anti-Flag (1:3,000 dilution, D110005, Sangon Biotech); rabbit anti-TBR1 (1:500 dilution, ab183032, Abcam); rat anti-CTIP2 (1:500 dilution, cab18465, Abcam); mouse anti-SATB2 (1:500 dilution, ab51502, Abcam); rat anti-CUX1 (1:500 dilution, ab307821, Abcam); goat anti-SOX2 (1:500 dilution, AF2018, Biotechne); rat anti-KI67 (1:500 dilution, 14-5698-82, ThermoFisher); goat anti-doublecortin (1:500 dilution, SC-8066, SANTA); rabbit anti-parvalbumin (1:500 dilution, ab181086, Abcam); donkey anti-DAPI (1:1,000 dilution; 28718-90-3, Sigma-Aldrich); donkey anti-rabbit IgG Alexa 488 (1:1,000 dilution; A32790; Thermo Fisher Scientific); donkey anti-rabbit IgG Alexa 555 (1:1,000 dilution; A32794; Thermo Fisher Scientific); donkey anti-mouse IgG Alexa 488 (1:1,000 dilution; A32766; Thermo Fisher Scientific); donkey anti-mouse IgG Alexa 555 (1:1,000 dilution; A32773; Thermo Fisher Scientific); donkey anti-rat IgG Alexa 555 (1:1,000 dilution; A48270; Thermo Fisher Scientific); donkey anti-goat IgG Alexa 555 (1:1,000 dilution; A32816; Thermo Fisher Scientific); and donkey anti-chicken Alexa Fluor 488 (1:1,000; 20166; Biotium).

RNA-seq

Brains were collected from mice and preserved in RNA later solution. The library samples were sent to Suzhou Hongxun Biotechnologies for RNA-seq. mRNA was transformed into cDNA using a TruSeq RNA Sample Prep kit v.2 (Illumina), and sequencing was carried out on an Illumina NovaSeq 6000 platform. The RNA-seq data were used to correct the full-length transcriptome sequence of mice through LoRDEC software. Differential expression analysis was performed using the DESeq2 R package (v.1.20.0)50. Gene ontology enrichment and KEGG analysis of differentially expressed genes was implemented by the clusterProfiler R package, in which gene length bias was corrected51.

ATAC–seq

Brain tissue was collected from mice at 10 weeks of age and immediately frozen in liquid nitrogen to preserve cellular integrity. The library samples were sent to Suzhou Azenta Life Science for ATAC–seq. Nuclei were isolated and subjected to a single PBS wash before lysis52. Nuclei were then directly processed with transposase to tagment accessible chromatin DNA, incorporating partial adapter sequences at the ends of fragmented DNA. Subsequent amplification enriched the library, with full Illumina sequencing adapters introduced to complete library construction. The resulting libraries were initially quantified and diluted using a Qubit fluorometer, followed by assessment of insert size and nucleic acid concentration with an Agilent 2100 Bioanalyzer. After pooling, the effective concentration of the combined libraries was precisely determined via qPCR to ensure accurate sequencing loading concentration and reliable data output. All computational analyses were conducted using a high-performance computing cluster, with results visualized using DESeq2 R package and IGV for downstream interpretation53.

Intravenous tail injection of AAVs in mice

To investigate the effect of ameliorating the aberrant phenotype in Chd3 hR1025W/+ mice after delivery of the TeABE system, AAV-PHP.eB-hSyn-GFP, AAV-PHP.eB-hSyn-nCas9-1-1029 and AAV-PHP.eB-hSyn-nCas9-1030-1248-TadA-F148A-nCas9-1264-1368-U6-sgRNA were packaged by PackGene Biotech. Virus titers were quantified by qPCR, and infectivity was evaluated by measuring fluorescence intensity following infection. Anaesthetized 6-week-old Chd3 hR1025W/+ mice (for the treatment group) were injected with a mixture of AAV-PHP.eB-hSyn-nCas9-1-1029 (100 μl of 5 × 1012 vg ml−1), AAV-PHP.eB-hSyn-nCas9-1030-1248-TadA-F148A-nCas9-1264-1368-U6-sgRNA (100 μl of 5 × 1012 vg ml−1) and AAV-PHP.eB-hSyn-GFP (10 μl of 5 × 1012 vg ml−1) into the tail vein. Chd3 +/+ mice (for the blank control group) and Chd3 hR1025W/+ mice (for the negative control group) were injected with AAV-PHP.eB-hSyn-nCas9-1-1029 (100 μl of 5 × 1012 vg ml−1), AAV-PHP.eB-hSyn-nCas9-1030-1248-TadA-F148A-nCas9-1264-1368-U6 (100 μl of 5 × 1012 vg ml−1) (no-targeting TeABE) and AAV-PHP.eB-hSyn-GFP (10 μl of 5 × 1012 vg ml−1).

Behavioural tests

The age of the mice subjected to behavioural tests and the P values for all behavioural experiments are detailed in Supplementary Table 6. These mice were handled for 4 days before testing. Behavioural data were recorded and analysed using Ethovision XT software (research resource identifier: SCR_000441, Noldus), with investigators blinded to the genotypes of the mice. Before testing, mice were habituated to the behavioural test room for at least 1 h to acclimate to the environment. The apparatus was thoroughly cleaned, and any residual odours were removed with deodorizer before and after each trial. During the tests, mice were allowed to move freely and explore the apparatus. All behavioural tasks were performed between 9:00 and 18:00, corresponding to the light phase of the light–dark cycle. Light intensity was standardized to 50 lux for the open-field, self-grooming, buried-marble and home-cage intruder social-interaction tests. An intensity of 80 lux was used for the three-chamber social interaction, novel object recognition, tail suspension, joint analysis, gait analysis, stride analysis and rota-rod test. The maximum light intensity was set to approximately 300 lux as an aversive stimulus for the elevated-plus maze and Barnes maze. Behavioural tests were conducted using protocols generally consistent with a previous report29.

USV test

USVs were elicited through a rapid maternal separation procedure conducted on pups at P3. To record USVs, pups were individually placed into a clean plastic container (containing bedding material) and subsequently placed inside a clean polystyrene container. The lid of the container was securely closed to minimize external noise and testing began immediately after placement. Each trial lasted for 5 min. The USVs were detected using an ultrasonic microphone (Ultravox Noldus), connected via the Ultravox device (Noldus) positioned near the pup’s location. Data were analysed using DeepSqueak (v.2.6.2), and the investigator conducting the data analysis was blinded to the genotypes of the mice.

Open-field test

The open-field test was performed in a custom-built apparatus made from 0.75-cm-thick white plastic, measuring 40 × 40 × 40 cm. At the start of each trial, a single mouse was placed at the centre of the box and allowed to explore freely for 10 min. Behaviour was recorded using a Da Hua high-definition video camera. For analysis, the total distance moved, average velocity, movement tracks and time spent in the centre zone (20 × 20 cm) were assessed using Ethovision XT software, and results were visualized with ImageJ. The investigator conducting the data analysis was blinded to the genotypes of the mice.

Buried marble test

A symmetrical 6 × 6 grid of 36 black glass marbles was arranged on 7 cm of bedding in a clean standard mouse cage measuring 40 × 40 cm2. Mice were introduced into the cage and allowed to explore for 10 min. Photographs were taken at the start and end of the exploration period to determine the number of marbles buried. A marble was considered buried if more than 50% of its surface was covered by bedding.

Social-intruder test

The task was conducted in the home cage of the experimental mouse, with the feed trough, food and water bottles removed. Mice were individually housed for 5 days to ensure social isolation and were acclimated to the experimental environment for 1 h before the task. The social recognition task consisted of two phases: a social approach and familiarity session, followed by a social novelty and recognition session. During the social approach and familiarity session, a stranger mouse (mouse 1; C57BL/6J adult male, 6 weeks old) was introduced into the cage for 3 min, allowing free exploration and interaction. This was followed by three additional trials with 5-min inter-trial intervals to facilitate familiarity with mouse 1. In the social novelty and recognition session, a new stranger mouse (a littermate of mouse 1) was introduced into the cage. Cumulative sniffing time was recorded to analyse social interaction, specifically when the test mouse actively sniffed or made physical contact with the stimulus mouse via nose touching. The recognition index was calculated as the difference in cumulative sniffing time between trials T5 and T4. Video recordings were captured using a Da Hua high-definition camera, and cumulative sniffing time was measured with a split-second chronograph. The investigator conducting data analysis was blinded to the genotypes of the mice.

The three-chamber social-interaction test

The three-chamber test was conducted using a behavioural apparatus made of 0.75-cm-thick white plastic (dimensions: 60 × 40 × 30 cm3). Each chamber was equipped with 4 × 4 cm2 cut-out doors in the partition walls to permit free movement between the chambers. Small iron cages were placed in each side chamber to house the social partner mice. The day before the testing, mice were habituated to the apparatus for 1 h with empty cages in both sides of the chambers. Social partner mice (C57BL/6J adult male, 6 weeks old) were placed in the iron cages for 10 min to minimize stress and anxiety. The test comprised habituation, social approach and social novelty. On the day of the test, the subject mouse was placed in the centre chamber and allowed to freely explore all three chambers during the habituation session. During the social approach session, while the test mouse remained in the centre chamber, a social partner mouse (mouse 1) was placed in the iron cage in one of the side chambers while the other iron cage was empty. The test mouse was then allowed to explore the entire apparatus for 10 min. In the social novelty session, the test mouse was returned to the centre chamber, and a new stranger mouse (mouse 2) was placed in the iron cage in the opposite side chamber. The test mouse was allowed to explore for another 10 min. The apparatus was thoroughly cleaned with a deodorizer between trials to eliminate any olfactory cues. Video recordings were captured using a Da Hua high-definition camera, and the time spent interacting with the social partner or the empty cage (20 × 10 cm2) and locomotion heatmaps were analysed using Ethovision XT software and plotted with ImageJ. The investigator analysing the data was unaware of the genotypes of the mice.

Novel object recognition test

The novel object recognition task was carried out using an apparatus made of 0.75-cm-thick white plastic, measuring 24 × 24 × 24 cm3. One day before the test, each mouse was placed individually into the apparatus for 1 h to habituate to the environment. During the habituation session, each test mouse was placed in the centre of the apparatus and allowed to freely explore for 10 min. On the training day, which took place 1 day after habituation, the test mouse was again placed in the centre of the apparatus and allowed to freely explore for 10 min. On the recognition session, held 1 day after the training session, the test mouse was placed in the centre of the apparatus and allowed to freely explore for 10 min. In the object recognition session, one red cube (object 1) was placed at the top corners of the apparatus. Then the test mouse was taken out and the box was deodorized with the deodorant. In the novel object recognition session, the test mouse was again placed in the centre of the apparatus and allowed to freely explore for 10 min. In this session, the red cube (object 1) and one green cylinder (novel object) were placed at the top corners of the apparatus. Video recordings were captured using a Da Hua high-definition camera during the task. The time spent interacting with each object (within a nose point range of ≤3 cm) and the locomotion heatmaps were analysed using Ethovision XT software and plotted using ImageJ. The investigator analysing the data was unaware of the genotypes of the mice.

Elevated-plus maze test

The elevated-plus maze test was performed using a specialized behavioural apparatus. The closed arms were made of 0.75-cm-thick white plastic boards, each measuring 30 × 5 × 15 cm, whereas the open arms measured 30 × 5 × 15 cm. The total height of the apparatus was 50 cm. Each test mouse was placed at the centre of the maze and allowed to freely explore for 5 min to fully navigate the maze. Video recordings were captured with a Da Hua high-definition camera. The time spent in the open and closed arms was recorded, and data analysis was conducted using Ethovision XT software and plotted with ImageJ. The investigator performing the analysis was unaware of the genotype of each mouse.

Barnes maze test

The Barnes maze consisted of a circular, thick, white plastic board with a diameter of 122 cm, featuring 40 evenly spaced holes, each 5 cm in diameter, around its perimeter. The maze stood 80 cm above the ground and was designed to rotate around its centre. An escape cage, made of black lightproof plastic, was positioned beneath the target hole for accessibility. Two bright supporting lamps placed at opposite ends provided maximum light intensity as an aversive stimulus. Between each trial, the maze and escape cage were thoroughly cleaned with deodorizer to eliminate residual odours, and the maze was randomly rotated to avoid olfactory cues. The Barnes maze test included five consecutive days of training followed by two test sessions on the sixth and thirteenth day. Before training, mice were habituated to the environment for at least 1 h. During each trial, a mouse was placed at the centre of the maze under a dark opaque plastic cover for approximately 10 s and then released to explore. Each mouse had up to 3 min to locate the escape hole; if unsuccessful, the mouse was guided to the target hole and allowed to familiarize itself with the location for 1 min inside the escape box, which was covered with an opaque plastic shield to reduce light exposure. Each mouse underwent two training trials daily (10 trials in total over 5 days) to memorize the target hole location and learn to navigate to it independently. On the test day, the escape box was removed, and each mouse was allowed to explore the maze freely for 180 s. Video recordings were captured using Da Hua Smart video recording software. The primary latency to reach the target or opposite zone was calculated within 180 s, and locomotion traces were analysed using Ethovision XT software and plotted with Image J. All analyses were performed by investigators who were unaware of the genotype of the mice.

Tail suspension test and joint laxity analysis

The tail suspension test was used to assess muscle tone in mice by observing limb clamping. Mice were suspended by their tails, and a high-definition digital camera was used to captured real-time images. The position of the limbs was monitored for 10 s. A scoring system was applied based on the limb posture: a score of 0 was assigned if both hindlimbs and forelimbs were consistently splayed outward, away from the abdomen; a score of 1 was given if one limb was retracted towards the abdomen for more than 50% of the suspension time; a score of 2 was assigned if half of the limbs were partially retracted towards the abdomen for more than 50% of the time; and a score of 3 was given if the three limbs were fully retracted and touching the abdomen for more than 50% of the time; and a score of 4 was given if both hindlimbs and forelimbs were fully retracted and touching the abdomen for more than 50% of the time54. The clasping scores of the mice were recorded and analysed with all analyses performed by investigators blinded to the genotypes of the mice.

For the analysis of joint laxity: a score of 0 indicated normal joints with no observable redness or swelling; a score of 1 indicated mild redness and swelling localized to the ankle or wrist, or limited redness and swelling confined to individual digits; a score of 2 indicated for moderate redness and swelling affecting the ankle or wrist; a score of 3 indicated severe redness and swelling involving the entire paw, including the digits; a score of 4 indicated maximal inflammation extending to multiple joints within the limb55. To ensure objectivity, all joint laxity scores were recorded and analysed by investigators blinded to the genotypes of the mice.

Gait analysis and stride analysis

Analysis was performed as in ref. 56. Step pattern tracking was performed using a tunnel constructed from three pre-cut clear acrylic panels, each 10 mm thick, allowing mice to walk comfortably and take at least four steps. The hindlimb foot angle and spacing were recorded using an electronic camera taken from their abdomen. Thick, smooth paper, such as watercolour paper, was cut into strips slightly larger than the tunnel dimensions (approximately 380 mm long and 90 mm wide). Two contrasting non-toxic, washable, water-based paints (for example, blue and red) were applied to distinguish between hindlimb (blue) and forelimb (red) steps. The selected paints were safe for ingestion, as mice tended to lick residual paint off their feet after testing. Step intervals were recorded for subsequent analysis.

Rotarod test

This test requires mice to balance on a rotating rod, and their latency to fall is recorded as the end-point measure57. The rotarod consists of a circular rod turning at a constant or increasing speed. Animals placed on the rotating rod try to remain on it rather than fall onto a platform some 30 cm below. Before the test, all mice are trained for 1 day to adapt to the rotarod instrument. On the test day, the mice are placed on the rotating lane of the rotarod instrument and the test starts. The time of the mice staying on the stick and the final velocity is recorded while the investigator conducting data analysis was blinded to the genotypes of the mice.

Intrathecal injections of AAV in monkeys

All experimental protocols and animal care and handling were approved by the Ethics Committee of the Kunming Medical University (Kmmu20205DS). All monkeys were pair-housed in accordance with standard operating procedures in a climate-controlled room at 18 °C to 26 °C with a relative humidity of 40–70%, a 12-h light–hour dark cycle, and a ventilation rate of eight times per hour. Monkeys had free access to drinking water and were continually fed with monkey chow (4% calories from fat, 16% calories from protein and 80% calories from carbohydrates) at 200–300 g per day. Monkeys were also provided a daily allotment of fruits, vegetables, or additional supplements and various toys.

Monkeys were anaesthetized with an intramuscular injection of ketamine hydrochloride (5 mg kg−1) followed by an intravenous injection of propofol (1 mg kg–1) to induce and maintain anaesthesia. Following anaesthesia induction, the lumbar area was shaved and disinfected with povidone–iodine. The animals were positioned in lateral recumbency on the surgical table with the lumbar spine flexed to facilitate access to the intervertebral spaces. A spinal needle was inserted at an approximately 70° angle to the dorsal midline axis into the intervertebral space between L3 and L4. The needle advanced through the skin and subcutaneous tissue into the subarachnoid space, which was identified by a distinct loss of resistance and confirmed by the appearance of cerebrospinal fluid after gentle aspiration. The mixture of dual AAV9 vectors (1,200 μl of 1.00 × 1014 vg per ml of each vector for high dose, 300 μl of 1.00 × 1014 vg per ml of each vector for low dose) was then administered slowly into the subarachnoid space over a period of 60 s58. Following the injection, the needle was removed, and the site was closed and disinfected. Monkeys were monitored post-procedure for recovery and potential adverse effects.

Immunohistochemistry staining for monkey samples

Monkeys were anesthetized with ketamine hydrochloride (veterinary drug approval number (2015)100761663 by the Ethics Committee of the Kunming Medical University; 10 mg kg–1, intramuscular) and pentobarbital (45 mg kg–1, intramuscular) and transcardially perfused with 2,000 ml of 4 °C PBS and 500 ml of 4% PFA (Sigma-Aldrich, 16005) in PBS. After perfusion, the hemispheres of the brain were dissected, cut into small blocks (segmentation of subregion for monkey brain were selected and collected by a skilled technician with over a decade of experience), fixed with 4% PFA in PBS. The fixed brain tissue blocks were then cut into 40-μm cortical sections with a Leica Biosystems (Leica CM1950). Sections were washed for 5 min in PBS containing 5% BSA and 2% Triton X-100, and incubated with primary antibodies (in PBS with 1% BSA and 2% Triton X-100) overnight at 4 °C and subsequently with corresponding secondary antibodies. DAPI (1:1,000 dilution; 28718-90-3, Sigma-Aldrich) was used to label the nuclei and sections were mounted with 75% glycerol. A classical rabbit anti-Cas9 antibody (1:500 dilution, ab204448, Abcam) was used to label Cas9.

Statistical analysis

All statistical data are presented as the mean ± s.d., with n representing the number of individual experiments or mice. Statistical analysis was conducted using Prism (v.6.01, GraphPad Software) and Origin (v.2019b) to assess group differences. The significance of differences between groups was evaluated using a paired or unpaired two-tailed Student’s t-test, one-way repeated-measures ANOVA or two-way ANOVA, as indicated in the figure legends. A paired two-tailed t-test was used to compare the cumulative time spent interacting with the mouse during the social approach and social novelty sessions in the three-chamber test for each mouse. A one-way repeated-measures ANOVA was used to analyse differences among more than two groups under a single-factor assumption. Two-way ANOVA was applied to examine interactions between two factors. An unpaired two-tailed t-test was used in other comparisons. Significance was determined as follows: *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001. Sample sizes were determined before the experiments without using any statistical methods. Mice were randomly assigned to experimental groups. Data collection and analyses were not conducted in a blinded manner except for the immunohistochemical and behavioural tests, which were performed blind to mouse genotype. Data distribution was assumed to be normal, although this was not formally tested.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Online content

Any methods, additional references, Nature Portfolio reporting summaries, source data, extended data, supplementary information, acknowledgements, peer review information; details of author contributions and competing interests; and statements of data and code availability are available at 10.1038/s41586-026-10113-6.

Supplementary information

Supplementary Information (1.8MB, docx)

This file contains Supplementary Figs. 1–5 and Supplementary Tables 1–12, 14 and 15. Supplementary Figs. 1–5 include raw protein and gel images, supplementary notes on base-editor efficacy, explanations of minimal protein mutation harm from bystander effects, off-target analysis of in vivo base editor injection, and mechanistic speculation on cell identity changes in mutant mice. Supplementary Tables 1–12, 14 and 15 include PCR primer sequences for NGS, plasmids for cell model construction, statistical methods and P values for mouse behaviour and other experiments, and target sites validating base-editor activity.

Reporting Summary (5.2MB, pdf)
Supplementary Table 13 (11.5MB, xlsx)

List of all identified genomic sites with read counts before and after filtering and consolidation in GUIDE-seq.

Peer Review File (1.4MB, pdf)
Supplementary Video 1 (33.3MB, mp4)

Rotarod performance in Chd3 hR1025W/+ mice after TeABE treatment compared with Chd3 hR1025W/+ mice with NT-TeABE. Symptoms of hypotonia of mice in the TeABE treatment group are alleviated and they remain longer on the rotarod as its speed increases.

Source data

Source Data Figs. 1–5 (43.9KB, xlsx)
41586_2026_10113_MOESM7_ESM.xlsx (75.5KB, xlsx)

Source Data Extended Data Figs. 1–10 and Supplementary Figs. 2–5.

Acknowledgements

We thank Y. Wang, L. Yue, Y. Li and S. Guo for technical assistance. Z.Q. and T.-L.C. are funded by the National Science and Technology Major Project (2025ZD0214700), NSFC (82430046), and the Project of Medical Technology Research and Transformation supported by Shanghai Municipal Health Commission (2024ZZ1007). K.Y. is funded by the Youth Innovation Promotion Association Chinese Academy of Sciences (2022269) and the National Natural Science Foundation of China (NSFC, 82001211). W.-K.L. is funded by NSFC (32400933). S.-H.W. is funded by the National Natural Science Foundation of China (82360226, 82471501) and the Key R&D Program of Yunnan Province (Major Project 202501AS070059). F.L. is funded by NSFC (82430104, 82125032, 81930095), the National Science and Technology Major Project (STI2030-Major Projects 2021ZD0200800), the Science and Technology Commission of Shanghai Municipality (19410713500, 23Y21900500, 23DZ2291100 and 2018SHZDZX01), the Shanghai Municipal Commission of Health and Family Planning (GWVI-11.1-34, 2020CXJQ01 and 2018YJRC03), the Innovative Research Team of High-level Local Universities in Shanghai (SHSMU-ZDCX20211100) and ‘Discipline Peak-Climbing Plan’ of Xinhua Hospital Affiliated to Shanghai Jiao Tong University School of Medicine (XKPF2024A50011). T.-L.C. is funded by NSFC (32371144). S.-Q.Z. is funded by NSFC (82401382).

Extended data figures and tables

Author contributions

K.Y., T.-L.C. and Z.Q. designed the study. K.Y. and W.-K.L. performed the plasmid construction. K.Y., Z.-K.X., R.-C.X., C.-X.L., J.W., R.Z. and Y.-X.G. carried out primary neuronal culture and molecular experiments. Y.-B.C., Y.-T.Y., Y.-F.Z. and K.Y. performed construction, identification and management of point mutant mice. W.-K.L., S.-Q.Z., X.-Y.Z., J.L. and T.-L.C. performed the editor design and in vitro efficiency verification. K.Y., Y.-X.G., Y.-T.Y., W.-K.L., W.-X.W., T.-Y.Z., P.-Y.W., J.F., G.-J.T., Z.-H.L. and T.-S.L. performed mouse virus injection and in vivo editing efficiency verification. K.Y., J.-W.W., W.-X.W., T.-Y.Z. and Z.-H.L. performed animal behavioural experiments. K.Y., Y.-X.G., J.-W.W., W.-X.W., P.-Y.W. and R.-C.X. performed the investigation of neurological abnormalities and improvements in mutant mice. S.-H.W., K.Y., Y.-X.G., W.-X.Y., J.-S.W., T.-Y.Z., J.F., W.-X.W., G.-J.T., C.-X.L., Z.-Y.Y., L.G. and W.Z. performed intrathecal injection and expression efficiency verification in monkeys. F.L., Z.Q. and K.Y. provided the experimental funds. K.Y., Y.-X.G. and Z.Q. wrote the manuscript. Z.Q., T.-L.C., F.L., J-S.L. and A.-L.D. revised the manuscript.

Peer review

Peer review information

Nature thanks the anonymous reviewers for their contribution to the peer review of this work. Peer reviewer reports are available.

Data availability

The NGS data generated in this study are publicly available at Figshare: monkey NGS (10.6084/m9.figshare.30607466)59; mouse bystander NGS (10.6084/m9.figshare.30597128)60; mouse off-target NGS (10.6084/m9.figshare.30587204)61. Related datasets generated in this study are publicly available at the NCBI: mouse ATAC–seq (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1363760); mouse RNA-seq (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1364147); and GUIDE-seq data (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1307829). All data from this study are available in the Supplementary InformationSource data are provided with this paper.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

These authors contributed equally: Kan Yang, Wei-Ke Li, Yi-Xiao Geng, Shu-Qian Zhang, Shi-Hao Wu, Yan-Bo Cheng

Change history

7/2/2026

In the version of this article initially published, in the Source Data, values for Fig. 4c were inadvertently duplicated from Extended Data Fig. 6d, while values for Extended Data Fig. 7b were duplicated from Extended Data Fig. 7f. The Source Data are now amended in the HTML version of the article.

Contributor Information

Kan Yang, Email: kanyang@shsmu.edu.cn.

Fei Li, Email: feili@shsmu.edu.cn.

Tian-Lin Cheng, Email: chengtianlin@fudan.edu.cn.

Zilong Qiu, Email: qiuzilong@shsmu.edu.cn.

Extended data

is available for this paper at 10.1038/s41586-026-10113-6.

Supplementary information

The online version contains supplementary material available at 10.1038/s41586-026-10113-6.

References

  • 1.Snijders Blok, L. et al. CHD3 helicase domain mutations cause a neurodevelopmental syndrome with macrocephaly and impaired speech and language. Nat. Commun.9, 4619 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Tie, X. et al. Insights from a novel splicing variant and recurrent arginine variants in the CHD3 gene causing Snijders Blok–Campeau syndrome. Am. J. Med. Genet.10.1002/ajmg.a.63930 (2024).
  • 3.Gillentine, M. A., Wang, T. & Eichler, E. E. Estimating the prevalence of de novo monogenic neurodevelopmental disorders from large cohort studies. Biomedicines10.3390/biomedicines10112865 (2022).
  • 4.Coursimault, J. et al. Hypersociability associated with developmental delay, macrocephaly and facial dysmorphism points to CHD3 mutations. Eur. J. Med. Genet.64, 104166 (2021). [DOI] [PubMed] [Google Scholar]
  • 5.Mizukami, M. et al. A de novo CHD3 variant in a child with intellectual disability, autism, joint laxity, and dysmorphisms. Brain Dev.43, 563–565 (2021). [DOI] [PubMed] [Google Scholar]
  • 6.Drivas, T. G. et al. A second cohort of CHD3 patients expands the molecular mechanisms known to cause Snijders Blok–Campeau syndrome. Eur. J. Hum. Genet.28, 1422–1431 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Pascual, P. et al. Snijders Blok–Campeau syndrome: description of 20 additional individuals with variants in CHD3 and literature review. Genes10.3390/genes14091664 (2023).
  • 8.Marfella, C. G. & Imbalzano, A. N. The Chd family of chromatin remodelers. Mutat. Res.618, 30–40 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Hargreaves, D. C. & Crabtree, G. R. ATP-dependent chromatin remodeling: genetics, genomics and mechanisms. Cell Res.21, 396–420 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Carvill, G. L. et al. Targeted resequencing in epileptic encephalopathies identifies de novo mutations in CHD2 and SYNGAP1. Nat. Genet.45, 825–830 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Vissers, L. E. et al. Mutations in a new member of the chromodomain gene family cause CHARGE syndrome. Nat. Genet.36, 955–957 (2004). [DOI] [PubMed] [Google Scholar]
  • 12.O’Roak, B. J. et al. Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations. Nature485, 246–250 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Woodage, T., Basrai, M. A., Baxevanis, A. D., Hieter, P. & Collins, F. S. Characterization of the CHD family of proteins. Proc. Natl Acad. Sci. USA94, 11472–11477 (1997). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Tencer, A. H. et al. Covalent modifications of histone H3K9 promote binding of CHD3. Cell Rep.21, 455–466 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Tong, J. K., Hassig, C. A., Schnitzler, G. R., Kingston, R. E. & Schreiber, S. L. Chromatin deacetylation by an ATP-dependent nucleosome remodelling complex. Nature395, 917–921 (1998). [DOI] [PubMed] [Google Scholar]
  • 16.Zhang, Y., LeRoy, G., Seelig, H. P., Lane, W. S. & Reinberg, D. The dermatomyositis-specific autoantigen Mi2 is a component of a complex containing histone deacetylase and nucleosome remodeling activities. Cell95, 279–289 (1998). [DOI] [PubMed] [Google Scholar]
  • 17.Lai, A. Y. & Wade, P. A. Cancer biology and NuRD: a multifaceted chromatin remodelling complex. Nat. Rev. Cancer11, 588–596 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Basta, J. & Rauchman, M. The nucleosome remodeling and deacetylase complex in development and disease. Transl. Res.165, 36–47 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Nitarska, J. et al. A functional switch of NuRD chromatin remodeling complex subunits regulates mouse cortical development. Cell Rep.17, 1683–1698 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Eising, E. et al. A set of regulatory genes co-expressed in embryonic human brain is implicated in disrupted speech development. Mol. Psychiatry24, 1065–1078 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Morgan, A. T., Amor, D. J., St John, M. D., Scheffer, I. E. & Hildebrand, M. S. Genetic architecture of childhood speech disorder: a review. Mol. Psychiatry29, 1281–1292 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Hsu, P. D., Lander, E. S. & Zhang, F. Development and applications of CRISPR–Cas9 for genome engineering. Cell157, 1262–1278 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Doudna, J. A. & Charpentier, E. Genome editing. The new frontier of genome engineering with CRISPR–Cas9. Science346, 1258096 (2014). [DOI] [PubMed] [Google Scholar]
  • 24.Anzalone, A. V., Koblan, L. W. & Liu, D. R. Genome editing with CRISPR–Cas nucleases, base editors, transposases and prime editors. Nat. Biotechnol.38, 824–844 (2020). [DOI] [PubMed] [Google Scholar]
  • 25.Komor, A. C., Kim, Y. B., Packer, M. S., Zuris, J. A. & Liu, D. R. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature533, 420–424 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Gaudelli, N. M. et al. Programmable base editing of A•T to G•C in genomic DNA without DNA cleavage. Nature551, 464–471 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Newby, G. A. & Liu, D. R. In vivo somatic cell base editing and prime editing. Mol. Ther.29, 3107–3124 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Koblan, L. W. et al. In vivo base editing rescues Hutchinson–Gilford progeria syndrome in mice. Nature589, 608–614 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Li, W.-K. et al. Whole-brain in vivo base editing reverses behavioral changes in Mef2c-mutant mice. Nat. Neurosci.27, 116–128 (2024). [DOI] [PubMed] [Google Scholar]
  • 30.Qi, M. et al. In vivo base editing of Scn5a rescues type 3 long QT syndrome in mice. Circulation149, 317–329 (2024). [DOI] [PubMed] [Google Scholar]
  • 31.Arbab, M. et al. Base editing rescue of spinal muscular atrophy in cells and in mice. Science380, eadg6518 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Jo, D. H., Bae, S., Kim, H. H., Kim, J. S. & Kim, J. H. In vivo application of base and prime editing to treat inherited retinal diseases. Prog. Retin. Eye Res.94, 101132 (2023). [DOI] [PubMed] [Google Scholar]
  • 33.Gao, Y. et al. Novel genotypes and phenotypes in Snijders Blok–Campeau syndrome caused by CHD3 mutations. Front. Genet.15, 1347933 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Shen, E. H., Overly, C. C. & Jones, A. R. The Allen Human Brain Atlas: comprehensive gene expression mapping of the human brain. Trends Neurosci.35, 711–714 (2012). [DOI] [PubMed] [Google Scholar]
  • 35.Abramson, J. et al. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature630, 493–500 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Cheng, T.-L. et al. Expanding C–T base editing toolkit with diversified cytidine deaminases. Nat. Commun.10, 3612 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Wang, X. et al. Efficient base editing in methylated regions with a human APOBEC3A–Cas9 fusion. Nat. Biotechnol.36, 946–949 (2018). [DOI] [PubMed] [Google Scholar]
  • 38.Li, S. et al. Docking sites inside Cas9 for adenine base editing diversification and RNA off-target elimination. Nat. Commun.11, 5827 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Wren, G. H. et al. Memory, mood and associated neuroanatomy in individuals with steroid sulphatase deficiency (X-linked ichthyosis). Genes Brain Behav.23, e12893 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Hoon, M. et al. Neuroligin-4 is localized to glycinergic postsynapses and regulates inhibition in the retina. Proc. Natl Acad. Sci. USA108, 3053–3058 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Lee, B. P. et al. The transcript expression levels of HNRNPM, HNRNPA0 and AKAP17A splicing factors may be predictively associated with ageing phenotypes in human peripheral blood. Biogerontology20, 649–663 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Liu, W. et al. ASMT determines gut microbiota and increases neurobehavioral adaptability to exercise in female mice. Commun. Biol.6, 1126 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Rees, H. A. & Liu, D. R. Base editing: precision chemistry on the genome and transcriptome of living cells. Nat. Rev. Genet.19, 770–788 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Gao, J. et al. Gene therapy for CNS disorders: modalities, delivery and translational challenges. Nat. Rev. Neurosci.25, 553–572 (2024). [DOI] [PubMed] [Google Scholar]
  • 45.Rothgangl, T. et al. In vivo adenine base editing of PCSK9 in macaques reduces LDL cholesterol levels. Nat. Biotechnol.39, 949–957 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Musunuru, K. et al. In vivo CRISPR base editing of PCSK9 durably lowers cholesterol in primates. Nature593, 429–434 (2021). [DOI] [PubMed] [Google Scholar]
  • 47.Musunuru, K. et al. Patient-specific in vivo gene editing to treat a rare genetic disease. N. Engl. J. Med.392, 2235–2243 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Kluesner, M. G. et al. EditR: a method to quantify base editing from sanger sequencing. CRISPR J.1, 239–250 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Malinin, N. L. et al. Defining genome-wide CRISPR–Cas genome-editing nuclease activity with GUIDE-seq. Nat. Protoc.16, 5592–5615 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol.15, 550 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Yu, G., Wang, L. G., Han, Y. & He, Q. Y. clusterProfiler: an R package for comparing biological themes among gene clusters. Omics16, 284–287 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Corces, M. R. et al. An improved ATAC–seq protocol reduces background and enables interrogation of frozen tissues. Nat. Methods14, 959–962 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Buenrostro, J. D., Wu, B., Chang, H. Y. & Greenleaf, W. J. ATAC–seq: a method for assaying chromatin accessibility genome-wide. Curr. Protoc. Mol. Biol.109, 21.29.1–21.29.9 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Guyenet, S. J. et al. A simple composite phenotype scoring system for evaluating mouse models of cerebellar ataxia. J. Vis. Exp.10.3791/1787 (2010).
  • 55.Inglis, J. J., Simelyte, E., McCann, F. E., Criado, G. & Williams, R. O. Protocol for the induction of arthritis in C57BL/6 mice. Nat. Protoc.3, 612–618 (2008). [DOI] [PubMed] [Google Scholar]
  • 56.Wertman, V., Gromova, A., La Spada, A. R. & Cortes, C. J. Low-cost gait analysis for behavioral phenotyping of mouse models of neuromuscular disease. J. Vis. Exp.10.3791/59878 (2019).
  • 57.Deacon, R. M. Measuring motor coordination in mice. J. Vis. Exp.10.3791/2609 (2013).
  • 58.Ineichen, B. V. et al. Direct, long-term intrathecal application of therapeutics to the rodent CNS. Nat. Protoc.12, 104–121 (2017). [DOI] [PubMed] [Google Scholar]
  • 59.Yang, K. The raw data of NGS of bystander and Off-target effects in monkey in extended data Fig. 10c–j. Figshare10.6084/m9.figshare.30607466 (2025).
  • 60.Yang, K. The raw data of NGS of on-target and bystander effects in mice in Fig. 3b–c and ED Fig. 5e–r. Figshare10.6084/m9.figshare.30597128 (2025).
  • 61.Yang, K. The raw data of NGS of off-target sites 1–4 in supplementary Fig. 4. Figshare10.6084/m9.figshare.30587204 (2025).

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Information (1.8MB, docx)

This file contains Supplementary Figs. 1–5 and Supplementary Tables 1–12, 14 and 15. Supplementary Figs. 1–5 include raw protein and gel images, supplementary notes on base-editor efficacy, explanations of minimal protein mutation harm from bystander effects, off-target analysis of in vivo base editor injection, and mechanistic speculation on cell identity changes in mutant mice. Supplementary Tables 1–12, 14 and 15 include PCR primer sequences for NGS, plasmids for cell model construction, statistical methods and P values for mouse behaviour and other experiments, and target sites validating base-editor activity.

Reporting Summary (5.2MB, pdf)
Supplementary Table 13 (11.5MB, xlsx)

List of all identified genomic sites with read counts before and after filtering and consolidation in GUIDE-seq.

Peer Review File (1.4MB, pdf)
Supplementary Video 1 (33.3MB, mp4)

Rotarod performance in Chd3 hR1025W/+ mice after TeABE treatment compared with Chd3 hR1025W/+ mice with NT-TeABE. Symptoms of hypotonia of mice in the TeABE treatment group are alleviated and they remain longer on the rotarod as its speed increases.

Source Data Figs. 1–5 (43.9KB, xlsx)
41586_2026_10113_MOESM7_ESM.xlsx (75.5KB, xlsx)

Source Data Extended Data Figs. 1–10 and Supplementary Figs. 2–5.

Data Availability Statement

The NGS data generated in this study are publicly available at Figshare: monkey NGS (10.6084/m9.figshare.30607466)59; mouse bystander NGS (10.6084/m9.figshare.30597128)60; mouse off-target NGS (10.6084/m9.figshare.30587204)61. Related datasets generated in this study are publicly available at the NCBI: mouse ATAC–seq (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1363760); mouse RNA-seq (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1364147); and GUIDE-seq data (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1307829). All data from this study are available in the Supplementary InformationSource data are provided with this paper.


Articles from Nature are provided here courtesy of Nature Publishing Group

RESOURCES